[galaxy-user] help for trim sequences

[Seung Hee Cho]

Hi, I am a galazy user and I want to trim exact sequences (not the
location) from 5' end. Is there any tool I can use for this?

For example,

*AATGATACGGCGAC­CACCG  **AACACTGCGTTTGCTGGCTTTG*ATG
>From this sequence, I want to remove *AATGATACGGCGAC­CACCG,*
*so I can get    "**AACACTGCGTTTGCTGGCTTTG*ATG" only.

If I use trim sequences or FASTX trimmer, then it will be trimmed absolute
position.
It would be great help. Thank you so much!

Best,

*Seung Hee *

___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

  http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

  http://lists.bx.psu.edu/

To search Galaxy mailing lists use the unified search at:

  http://galaxyproject.org/search/mailinglists/