Hi Qianli,
It looks as if you are using the Extract DNA tool? GTF/GFF files have
coordinates with a 1-based start position - and this was your input, but
the output from this tool produces coordinates with a BED-style 0-based
start position.
The genome index files used by the tool are in .2bit format and the
source is encoded into the full name. The sequence content of the
reference genome is not altered by the tool. Perhaps the interpretation
of the coordinates is the source of the difference or you are sourcing a
different version? If you have a question about where we sourced a
genome, please let us know.
To see a quick description of both BED and GFF format together in the
UI, click into the tool "Convert Formats -> GFF-to-BED converter". For
more in-depth descriptions, please see our wiki:
http://wiki.g2.bx.psu.edu/Learn/Datatypes
Next time, please send questions directly to our mailing list, with the
"to" address as galaxy-u...@bx.psu.edu.
Best,
Jen
Galaxy team
On 6/8/12 7:07 AM, Qianli Shen wrote:
Hello
I ran a preliminary analysis using test genome and gff file. But the
results is confusing me.
The fasta file is
>Gm06
ATAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTA
AACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAAC
CCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCT
AAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACC
The gff3 file is
##gff-version 3
Gm06 GDB element 5 15 . + . ID=LEVEL1;Name=Glyma06g05000;
The output is
>?_Gm06_4_15_+
ACCCTAAACCC
1 From the gff3 file we can see the start and end position is 5 and 15,
why the start and end coordinate is 4 and 15 in the output file, which
is really confusing.
2 How does the galaxy treat the genome file, are all the characters
except for ACGT are removed from the genome file? Because I use substr
function in Perl to test the output of galaxy, somethimes, there is
mismatch.
I really appreciate all your help.
qianli
--
Qianli Shen
Graduate Student
Ohio State University
Department of Horticulture and Crop Science
Email: qianlipotent...@gmail.com <mailto:qianlipotent...@gmail.com>
shen....@buckeyemail.osu.edu <http://goog_1606040974>
<http://goog_1606040974>
--
Jennifer Jackson
http://galaxyproject.org
___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using "reply all" in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
