Re: [galaxy-user] biomart plugin

2011-03-28 Thread Greg Von Kuster
Hello Andrea, Make a copy of the ~/tools/data_source/biomart.xml for your local biomart install, and change the action in the following tag to point to it. inputs action=http://www.biomart.org/biomart/martview; check_values=false method=get target=_top Then add your new biomart tool wrapper

Re: [galaxy-user] Convert SOLiD data

2011-03-28 Thread Ryan Golhar
Lishiyong, You should not convert colorspace to base space prior to aligning reads. The reason for this is that if there is an error in one of the color calls, it will effect all the downstream color calls. Instead, you should use an aligner that will do the assembly in color-space

Re: [galaxy-user] Convert SOLiD data

2011-03-28 Thread Jennifer Jackson
Hello Lishiyong, Just to confirm, the conversion was performed at Galaxy main using NGS: QC and manipulation - Convert SOLiD output to fastq? With the option double encode = yes? If so, the output appears to be correct. quote from tool help: Double encode? - converts color calls (0123.) to

Re: [galaxy-user] Sort index SAM-files automatically

2011-03-28 Thread Ryan Golhar
Jo, Use the SAM Tools SAM-TO-BAM tool in Galaxy to convert your SAM file to a BAM file. Ryan On 3/25/11 10:35 AM, Jochen Seggewiß wrote: Hi! Thank you for your reply. So that means, I should convert the csfasta qual to fastq, map it with Bowtie, get an SAM, convert it to BAM and then

Re: [galaxy-user] Convert SOLiD data

2011-03-28 Thread Sher, Falak
Hello collegues, I have two questions which I could not get answered. I have Illumina single end sequences files, and want to use them for ChIP-Seq analysis. My first question is: In Galaxy screencasts (ChIP-Seq analysis for TAF1-protein...) he does not tell how he has generated the txt. format

Re: [galaxy-user] galaxy-user Digest, Vol 57, Issue 26

2011-03-28 Thread Brian Lam
to be TCCTAGACAAGTTGGCTTTCCCTTAAACAGCTGACATAGAGATATGTCCC Who knows the reason about this. 2011-03-28 lishiyong -- next part -- An HTML attachment was scrubbed... URL: http://lists.bx.psu.edu/pipermail/galaxy-user/attachments/20110328/43b70c8a/attachment-0001.html

Re: [galaxy-user] Convert SOLiD data

2011-03-28 Thread Peter Cock
On Mon, Mar 28, 2011 at 3:11 PM, Sher, Falak wrote: My second question is, 2) How can I convert SAM/BAM formated files (generated by Bowtie mapping tool at Galaxy) to Wiggle or Bigwig formats. Brad Chapman has written a Galaxy tool for converting BAM to BigWig, called Calculates coverage from

Re: [galaxy-user] Convert SOLiD data

2011-03-28 Thread Jennifer Jackson
Hello Falak, In the screencast, the data for the TAF1- binding sites is from the ENCODE pilot project. You can find many TAF1 datasets (ChIP-chip and ChIP-seq) at the ENCODE DCC: http://genome.ucsc.edu/ENCODE Is it that you want to use your own data (after it is mapped) and compare to

Re: [galaxy-user] galaxy-user Digest, Vol 57, Issue 26

2011-03-28 Thread Jennifer Jackson
�� AGAGTGGCCAGCACATGAAGAAGATAACCGTGCGCCTTTTTCCGAA But I think it should to be TCCTAGACAAGTTGGCTTTCCCTTAAACAGCTGACATAGAGATATGTCCC Who knows the reason about this. 2011-03-28 lishiyong -- next part -- An HTML attachment was scrubbed... URL:http://lists.bx.psu.edu/pipermail/galaxy-user/attachments/20110328/43b70c8a

Re: [galaxy-user] Problems using aaChanges tool

2011-03-28 Thread Jennifer Jackson
Hi Evan, The update to include zebrafish (and a few other genomes) should roll out to Galaxy main in the next few days, if not sooner. Feel free to check back Friday for an update if you do not see it there by then. Thank you for your patience! Best, Jen Galaxy team On 3/28/11 8:01 AM,

Re: [galaxy-user] server error trying to DL data from galaxy on cloud

2011-03-28 Thread karlerhard
Hello, I'm trying to download the library files I processed on my galaxy cloud instance, but I'm getting an error. At the top (on the right panel) it says Server Error and then lists the URL where the data should be and then lists: Module paste.exceptions.errormiddleware:143 in __call__

Re: [galaxy-user] A genbank to gtf converter

2011-03-28 Thread David Matthews
Hi Jen, Many thanks for the reply. Sadly my programming is not up to anything like a gbk to gtf converter! The main reason I want one is that as a virologist this would be very useful since many viruses do not have a gtf file but do have genbank submissions. I know of a site that has some

Re: [galaxy-user] server error trying to DL data from galaxy on cloud

2011-03-28 Thread Enis Afgan
Hi Karl, Hmm, not having Galaxy accessible is definitely not a step in the right direction. Being signed into command line is not an issue; something else must have gone wrong. To start, please take a look at the (bottom of) galaxy log file (and email the relevant part if you don't see how to fix

Re: [galaxy-user] Pseudo Autosomal regions in Chrs X and Y

2011-03-28 Thread David Matthews
Hi, Again, thanks for the feedback. I made my own female hg19 by deleting chrY from my copy of hg19 so thats OK. It still leaves the problem of how to analyse male transcriptomes since maps to PAR1 and 2 genes get reported as multimap reads which can end up being filtered out depending on how

Re: [galaxy-user] Pseudo Autosomal regions in Chrs X and Y

2011-03-28 Thread Hiram Clawson
Listed on the hg19 gateway page at the UCSC genome browser. - Original Message - From: David Matthews d.a.matth...@bristol.ac.uk To: Jennifer Jackson j...@bx.psu.edu Cc: galaxy-u...@bx.psu.edu Sent: Monday, March 28, 2011 2:04:02 PM Subject: Re: [galaxy-user] Pseudo Autosomal regions in

Re: [galaxy-user] server error trying to DL data from galaxy on cloud

2011-03-28 Thread Enis Afgan
You're almost there, the command should be executed from your local machine (home directory is fine) and it should look as follows: scp -i path to keyfile ubuntu@publicDNS:/mnt/galaxyData/files/000/dataset_11.dat . (note the 'ubuntu@' before the public DNS and a trailing dot (.) - the dot means

Re: [galaxy-user] Pseudo Autosomal regions in Chrs X and Y

2011-03-28 Thread Jennifer Jackson
Hi David, The PAR regions are documented at UCSC on the hg19 genome gateway page (and for some other recent genomes). Start at the main page, click into Genomes, select hg19, then scroll down to credits: http://genome.ucsc.edu/ quote: The Y chromosome in this assembly contains two

Re: [galaxy-user] server error trying to DL data from galaxy on cloud

2011-03-28 Thread karlerhard
Excellent, it was the trailing dot that I was missing! Thanks so much for the help, I will most certainly be using Galaxy again, it's been very useful so far. karl You're almost there, the command should be executed from your local machine (home directory is fine) and it should look as