Re: [galaxy-user] Help: Mapping with Bowtie does not start
Hello Meike, We had a known period of delay last week - hopefully your job was able to processes in the time since then. This is how you can determine a job's status: https://wiki.galaxyproject.org/Support#Dataset_status_and_how_jobs_execute The Main site is down right now, but watch our @galaxyproject twitter feed for updates. If you don't use twitter, you can still follow the tweets at this wiki: https://wiki.galaxyproject.org/Galaxy%20on%20Twitter Thanks! Jen Galaxy team On 3/7/14 1:20 AM, meike.l...@mdc-berlin.de wrote: Hello, I am trying to map sequences with Bowtie for Illumina. I have been waiting for a whole day now but it still says Job is waiting to run. Are the jobs stuck in a queue or is there any other problem? Thanks a lot in advance! Meike ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-user] Help: Mapping with Bowtie does not start
Hello, I am trying to map sequences with Bowtie for Illumina. I have been waiting for a whole day now but it still says Job is waiting to run. Are the jobs stuck in a queue or is there any other problem? Thanks a lot in advance! Meike ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] Help with Cuffdiff
Hi Maria, I didn't notice any obvious problematic usage, format, or content issues with the Tuxedo pipeline execution in your history. Your protocol is right on track. This leaves data and parameter inputs to consider. I did notice that you are mainly using defaults and omitting the use of reference annotation that Cuffdiff uses to generate the full compliment of statistics. The NOTEST result indicates that the coverage is too shallow. You could follow the advice here, by adjusting -c to be lower. This is Min Alignment Count: and is set to 10 in your runs. http://cufflinks.cbcb.umd.edu/faq.html#notest Adding in a reference annotation file could also potentially help. Aligned sequences may be falsely fragmenting without a reference transcript to help bind them together. But, this is just a guess - I didn't examine any assembly regions. This is however something that you could do. The UCSC Table Browser is one source for a GTF file. Experimenting with other parameters as you are doing also is worth it. The manual and such cover these in detail, and there is always the tool author's google group for detailed questions/advice. Good luck with your project, Jen Galaxy team On 2/6/14 12:38 PM, Maria Hoffman wrote: Hello, Thank you for your help. I have found that wiki page very helpful and actually us it very often (I was using it this AM too before I emailed you). In looking at the wiki again, nothing is really standing out to me ( my chromosome notation matches up etc). I am going to keep looking etc but I did send you my history too. I did try running another cuffdiff playing with the dispersion estimation method too out of curiosity. Thank you so much for your help! This is my first real data set doing this and we have abstracts due soon, so the pressure is on! Thanks! Maria -- Jennifer Hillman-Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-user] Help with Cuffdiff
Hello, I am new to cuff diff and just got my data output back and it doesn't look like anything is statistically significant. There are three treatment groups with two biological replicates each group. I am not sure if I made an error somewhere along the line, need to adjust the parameters, or if there really could be no change. The samples are from sheep and I have been using the OvisAries3.0 reference I downloaded from UCSC. Thanks Maria ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] Help with Cuffdiff
Hi Maria, More details are needed to help. Would you like to share a history with me? You might also find the tutorials and other resources for RNA-seq analysis we have helpful. Many are linked from here: https://wiki.galaxyproject.org/Support#Tools_on_the_Main_server:_RNA-seq I've also added the latest sheep build to the set of genomes to be indexed for the RNA-seq mapping tools (bowtie bowtie2). I'll try to include them in the upcoming snapshot if at all possible. But if not this one (is nearing completion), will be added to the next. Please review the help, then send me a share link if the suggested protocols are not addressing your questions (direct). Jen Galaxy team On 2/6/14 9:09 AM, Maria Hoffman wrote: Hello, I am new to cuff diff and just got my data output back and it doesn't look like anything is statistically significant. There are three treatment groups with two biological replicates each group. I am not sure if I made an error somewhere along the line, need to adjust the parameters, or if there really could be no change. The samples are from sheep and I have been using the OvisAries3.0 reference I downloaded from UCSC. Thanks Maria ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-user] Help
Hi all, we are two new galaxy users. We have developed 2 new tools and we would connect them into a new workflow. We are able to import both tools and to link them into a workflow but we aren't able to pass the output of the first tool as the input of the second tool. The first tool calls a bash script that produces a simple string (this is the path of the file generated by the script). This is the xnl file of the first tool: tool id=infnTools_ConcatenateArgumentsTool name=Concatenate Arguments and generate file Tool descriptionConcatenate arguments strings and generate file/description command interpreter=bashconcatenateArgumentsAndPutFile.sh $inputArguments/command inputs param name=inputArguments type=text label=ARGUMENTS optional=false/ /inputs outputs data format=string name=output / /outputs /tool This is the bash script of the first tool (concatenateArgumentsAndPutFile.sh): #!/bin/bash echo ARGUMENTS: $@ export PathFile=/tmp/$RANDOM$RANDOM echo $@ $PathFile echo PathFile: $PathFile The xml of the second tool is the following: tool id=infnTools_InsertBiomasTools name=InsertJobs and check the status of Biomas descriptionInsertJobs Biomas Tool and check the status/description command interpreter=bashinsertAndCheckBiomasJobs.sh $input /command inputs param format=string name=input type=data label=Insert path file/ /inputs outputs data format=tabular name=output/ /outputs /tool When we run the workflow the output of the first tool isn't seen as input of the second tool. Into the galaxy history we see this value for the input of the second tool: /home/pasquale/galaxy-dist/database/files/000/dataset_83.dat Also this file is emtpy. How we can resolve the problem? Thanks and best regard Pasquale Alfonso Dott. Pasquale Notarangelo INFN Istituto Nazionale di Fisica Nucleare - Sezione Bari Via Orabona, 4 - 70126 Bari, Italy Tel. ufficio: +39 080-5443194 Interno ufficio: 3194 Mail: pasquale.notarang...@ba.infn.it Skype: pasquale.notarangelo_1985 Msn: pasqualenotarang...@hotmail.it Gmail: notarangelo@gmail.com ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] Help
Hi Pasquale, From a quick look (and I am not the tool-building expert of our team!), I suspect that the problem is with the format assigned to the output of the first tool, and input of the second tool. Specifically, format=string is problematic, unless you have also defined this in your local install. Even then, having it contain a path to a file deviates from the regular usage (if I have understood your snippet of code correctly). Our wiki for tool configuration is located here. The wiki has examples, but you can also look at tools in the source code or Tool shed repos to see how format is used. https://wiki.galaxyproject.org/Admin/Tools/ToolConfigSyntax I don't want to send you away from this list, since I know that you already emailed earlier, but the galaxy-...@bx.psu.edu mailing list is where most tool development questions are discussed. That said, when troubleshooting, individual scripts are not often corrected by the community if the answer is already in the wiki, existing code base, or in a prior discussion. So, making use of these resources is the first place to start. There is a search tool for development topics that can be of great use to locate the bits for you that can be helpful: http://galaxyproject.org/search/ Try a search with Admin Development - I found in the first few hits this link, which includes the tool config link above plus many other related resources listed at the bottom: https://wiki.galaxyproject.org/Admin/Tools/Add%20Tool%20Tutorial Hopefully this helps a little, and others reading the post are welcome to add in more of course! Jen Galaxy team On 1/13/14 7:31 AM, Pasquale Notarangelo wrote: Hi all, we are two new galaxy users. We have developed 2 new tools and we would connect them into a new workflow. We are able to import both tools and to link them into a workflow but we aren't able to pass the output of the first tool as the input of the second tool. The first tool calls a bash script that produces a simple string (this is the path of the file generated by the script). This is the xnl file of the first tool: tool id=infnTools_ConcatenateArgumentsTool name=Concatenate Arguments and generate file Tool descriptionConcatenate arguments strings and generate file/description command interpreter=bashconcatenateArgumentsAndPutFile.sh $inputArguments/command inputs param name=inputArguments type=text label=ARGUMENTS optional=false/ /inputs outputs data format=string name=output / /outputs /tool This is the bash script of the first tool (concatenateArgumentsAndPutFile.sh): #!/bin/bash echo ARGUMENTS: $@ export PathFile=/tmp/$RANDOM$RANDOM echo $@ $PathFile echo PathFile: $PathFile The xml of the second tool is the following: tool id=infnTools_InsertBiomasTools name=InsertJobs and check the status of Biomas descriptionInsertJobs Biomas Tool and check the status/description command interpreter=bashinsertAndCheckBiomasJobs.sh $input /command inputs param format=string name=input type=data label=Insert path file/ /inputs outputs data format=tabular name=output/ /outputs /tool When we run the workflow the output of the first tool isn't seen as input of the second tool. Into the galaxy history we see this value for the input of the second tool: /home/pasquale/galaxy-dist/database/files/000/dataset_83.dat Also this file is emtpy. How we can resolve the problem? Thanks and best regard Pasquale Alfonso Dott. Pasquale Notarangelo INFN Istituto Nazionale di Fisica Nucleare - Sezione Bari Via Orabona, 4 - 70126 Bari, Italy Tel. ufficio: +39 080-5443194 Interno ufficio: 3194 Mail: pasquale.notarang...@ba.infn.it Skype: pasquale.notarangelo_1985 Msn: pasqualenotarang...@hotmail.it Gmail: notarangelo@gmail.com ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the
Re: [galaxy-user] help for trim sequences
You might also use ( / add to main) the CutAdapt tool, which is available in the main toolshed. It takes multiple adapters, allows 3/5/both side adapters, and is fast. http://toolshed.g2.bx.psu.edu/repository/view_repository?sort=User.usernameoperation=view_or_manage_repositoryid=f19bc86bac946438 Best, Geert On 11/23/2013 03:19 PM, Peter Cock wrote: On Fri, Nov 22, 2013 at 8:48 PM, Jennifer Jackson j...@bx.psu.edu wrote: Hi Seung Hee, I know we discussed this on the other list, but I didn't point you to the open development ticket to (potentially) extend the functions of the Cut tool. This is not being actively worked on right now, but you can follow it for updates if you want. https://trello.com/c/CbFSHrU5 Others are still welcome to comment about what types of solutions they might have to offer. There is no specific tool to do this on Main right now (or in the Tool Shed, from my checks). http://usegalaxy.org/toolshed This tool of mine might do what Seung Hee wanted, but I have not tried it on very large Illumina datasets: http://toolshed.g2.bx.psu.edu/view/peterjc/seq_primer_clip Regards, Peter ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Geert Vandeweyer, Ph.D. Department of Medical Genetics University of Antwerp Prins Boudewijnlaan 43 2650 Edegem Belgium Tel: +32 (0)3 275 97 56 E-mail: geert.vandewe...@ua.ac.be http://ua.ac.be/cognitivegenetics http://www.linkedin.com/in/geertvandeweyer ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] help for trim sequences
Thanks Geert, This tool was in the back on my mind, but I couldn't find it last week for some reason! Seung Hee - this is a very good choice, for use in a local or or cloud Galaxy. http://getgalaxy.org http://usegalaxy.org/cloud I think I will close out the ticket below and point it to CutAdapt as a solution. A ticket to ask for this tool to be on Main is a distinct subject/issue - if someone wants to submit that request, the community can vote, team can priotitize, etc. http://wiki.galaxyproject.org/Issues The tool Peter mentions can also be examined. One may fit your needs better than the other, Thanks!! Jen Galaxy team On 11/25/13 6:03 AM, Geert Vandeweyer wrote: You might also use ( / add to main) the CutAdapt tool, which is available in the main toolshed. It takes multiple adapters, allows 3/5/both side adapters, and is fast. http://toolshed.g2.bx.psu.edu/repository/view_repository?sort=User.usernameoperation=view_or_manage_repositoryid=f19bc86bac946438 Best, Geert On 11/23/2013 03:19 PM, Peter Cock wrote: On Fri, Nov 22, 2013 at 8:48 PM, Jennifer Jacksonj...@bx.psu.edu wrote: Hi Seung Hee, I know we discussed this on the other list, but I didn't point you to the open development ticket to (potentially) extend the functions of the Cut tool. This is not being actively worked on right now, but you can follow it for updates if you want. https://trello.com/c/CbFSHrU5 Others are still welcome to comment about what types of solutions they might have to offer. There is no specific tool to do this on Main right now (or in the Tool Shed, from my checks).http://usegalaxy.org/toolshed This tool of mine might do what Seung Hee wanted, but I have not tried it on very large Illumina datasets: http://toolshed.g2.bx.psu.edu/view/peterjc/seq_primer_clip Regards, Peter ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Geert Vandeweyer, Ph.D. Department of Medical Genetics University of Antwerp Prins Boudewijnlaan 43 2650 Edegem Belgium Tel: +32 (0)3 275 97 56 E-mail:geert.vandewe...@ua.ac.be http://ua.ac.be/cognitivegenetics http://www.linkedin.com/in/geertvandeweyer ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] help for trim sequences
Thanks Peter for another option! Jen Galaxy team On 11/23/13 6:19 AM, Peter Cock wrote: On Fri, Nov 22, 2013 at 8:48 PM, Jennifer Jackson j...@bx.psu.edu wrote: Hi Seung Hee, I know we discussed this on the other list, but I didn't point you to the open development ticket to (potentially) extend the functions of the Cut tool. This is not being actively worked on right now, but you can follow it for updates if you want. https://trello.com/c/CbFSHrU5 Others are still welcome to comment about what types of solutions they might have to offer. There is no specific tool to do this on Main right now (or in the Tool Shed, from my checks). http://usegalaxy.org/toolshed This tool of mine might do what Seung Hee wanted, but I have not tried it on very large Illumina datasets: http://toolshed.g2.bx.psu.edu/view/peterjc/seq_primer_clip Regards, Peter -- Jennifer Hillman-Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] help for trim sequences
Hi Seung Hee, You can request that this tool be added to the public Main server at usegalaxy.org through Trello and the team will consider it. For right now, the options are local or cloud. (as in my other reply) Or, you can look around the the other public servers hosted by our community - each is run by a distinct group with their own contact/help/public-use criteria: http://wiki.galaxyproject.org/PublicGalaxyServers It may be simplest to see if a local will do the job, then upload the results to the public server for downstream analysis. Just do the very basics of a production server install and then add the tool to test it out. This will take some line commands to set up, but shouldn't be too much of an investment. The links are: http://getgalaxy.org http://usegalaxy.org/toolshed http://wiki.galaxyproject.org/Tool%20Shed#Installing.2C_maintaining_and_uninstalling_tool_shed_repositories_within_a_Galaxy_instance Local install help/discussion: galaxy-...@bx.psu.edu Subscribe or search prior Q/A: http://wiki.galaxyproject.org/MailingLists Take care, Jen Galaxy team On 11/25/13 11:29 AM, Seung Hee Cho wrote: Thank you for much for your great help! I am trying to use this tool but I am wondering if I can use this CutAdapt tools on the public server. I was working on my job on the public server, so if not I need download it for use. I truly appreciate your help! Best, *Seung Hee Cho* Contreras Research Group, CPE 5.416 The University of Texas at Austin Department of Chemical Engineering 200 E Dean Keeton St. Stop C0400 Austin, TX 78712-1589 On Mon, Nov 25, 2013 at 10:08 AM, Jennifer Jackson j...@bx.psu.edu mailto:j...@bx.psu.edu wrote: Thanks Peter for another option! Jen Galaxy team On 11/23/13 6:19 AM, Peter Cock wrote: On Fri, Nov 22, 2013 at 8:48 PM, Jennifer Jackson j...@bx.psu.edu mailto:j...@bx.psu.edu wrote: Hi Seung Hee, I know we discussed this on the other list, but I didn't point you to the open development ticket to (potentially) extend the functions of the Cut tool. This is not being actively worked on right now, but you can follow it for updates if you want. https://trello.com/c/CbFSHrU5 Others are still welcome to comment about what types of solutions they might have to offer. There is no specific tool to do this on Main right now (or in the Tool Shed, from my checks). http://usegalaxy.org/toolshed This tool of mine might do what Seung Hee wanted, but I have not tried it on very large Illumina datasets: http://toolshed.g2.bx.psu.edu/view/peterjc/seq_primer_clip Regards, Peter -- Jennifer Hillman-Jackson http://galaxyproject.org -- Jennifer Hillman-Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] help for trim sequences
On Fri, Nov 22, 2013 at 8:48 PM, Jennifer Jackson j...@bx.psu.edu wrote: Hi Seung Hee, I know we discussed this on the other list, but I didn't point you to the open development ticket to (potentially) extend the functions of the Cut tool. This is not being actively worked on right now, but you can follow it for updates if you want. https://trello.com/c/CbFSHrU5 Others are still welcome to comment about what types of solutions they might have to offer. There is no specific tool to do this on Main right now (or in the Tool Shed, from my checks). http://usegalaxy.org/toolshed This tool of mine might do what Seung Hee wanted, but I have not tried it on very large Illumina datasets: http://toolshed.g2.bx.psu.edu/view/peterjc/seq_primer_clip Regards, Peter ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
Re: [galaxy-user] help for trim sequences
Hi Seung Hee, I know we discussed this on the other list, but I didn't point you to the open development ticket to (potentially) extend the functions of the Cut tool. This is not being actively worked on right now, but you can follow it for updates if you want. https://trello.com/c/CbFSHrU5 Others are still welcome to comment about what types of solutions they might have to offer. There is no specific tool to do this on Main right now (or in the Tool Shed, from my checks). http://usegalaxy.org/toolshed Take care, Jen Galaxy team On 11/18/13 12:56 PM, Seung Hee Cho wrote: Hi, I am a galazy user and I want to trim exact sequences (not the location) from 5' end. Is there any tool I can use for this? For example, *AATGATACGGC_GACCACCG _*_AACACTGCGTTTGCTGGCTTTG_ATG From this sequence, I want to remove *AATGATACGGC_GACCACCG,_* *_so I can get _ *_AACACTGCGTTTGCTGGCTTTG_ATG only. If I use trim sequences or FASTX trimmer, then it will be trimmed absolute position. It would be great help. Thank you so much! Best, *Seung Hee * ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/ -- Jennifer Hillman-Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-user] help for trim sequences
Hi, I am a galazy user and I want to trim exact sequences (not the location) from 5' end. Is there any tool I can use for this? For example, *AATGATACGGCGACCACCG **AACACTGCGTTTGCTGGCTTTG*ATG From this sequence, I want to remove *AATGATACGGCGACCACCG,* *so I can get**AACACTGCGTTTGCTGGCTTTG*ATG only. If I use trim sequences or FASTX trimmer, then it will be trimmed absolute position. It would be great help. Thank you so much! Best, *Seung Hee * ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ To search Galaxy mailing lists use the unified search at: http://galaxyproject.org/search/mailinglists/
[galaxy-user] help
Hello; I am having the following problems with RNAseq using galaxy; we have installed the Galaxy local version on local server. 1. FastQC not running . gives an error and doesn't run on groomed or un-groomed FastQ file. The error message shows in the below pic. 2. No reference genomein the drop down list in TOPHAT for illumine tool and TOPHAt2. Any solution? Thank you Mira [image001] Mira Bosso, M.Sc, B.D.S Research associate Pancreatic Islet Biology and Transplantation Unit P.O.Box 1180, Dasman 15462, Kuwait Phone: +965 2224 2999 Ext.2803 Mob: +96599500197 Email: mira.bi...@dasmaninstitute.orgmailto:mira.bi...@dasmaninstitute.org inline: image001.png___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Help to identify variants with clinical/phenotype associations
Hi all, I have a dataset with potential pathological variants and I'd like to combine them to a dataset with known clinical association variants to identify those responsible for the phenotype. I'll thank a lot any suggestion. -- *J. Luis Santomé Collazo* ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] help
Hello Pranathi, Sorry that you are having problems. Instead, use this Galaxy tool and the links directly between Galaxy and SRA to add the fastq data to your history: 1 - Get Data - EBI SRA ENA SRA 2 - Enter SRR192339 into the query box and click on search 3 - At the far right in the bottom table, under the Fastq tab, find a column named Galaxy, and under it a link for this data Fastq file#1. Click on this, and the dataset should start loaded into the current active history. When you import data, be sure to note the other information about the experiment on the SRA form, so that you will know how to prepare the data for use in Galaxy. Note that you cannot load HTML data into Galaxy, so the index itself cannot be transferred directly. However you could copy and paste this into a plain text file (plain .txt, not .html), and upload that, if you wanted to keep a tracking history with the data. This particular data was generated by the Illumina Genome Analyzer IIx technology, which creates data that is compatible with .fastqsanger format in Galaxy. It is also single end. This simplifies the data prep - simply assign the datatype as .fastqsanger and it is ready to use with tools. Starting with FastQC is generally considered a good idea. Good luck with your project, Jen Galaxy team ps: Please note the corrected mailing list address galaxy-u...@bx.psu.edu. http://wiki.g2.bx.psu.edu/MailingLists On 10/19/12 11:31 PM, pranathi pappu wrote: Dear Sir /Madam , I have been i have been trying to upload NGS Datasets from NCBI protein database onto the Galaxy website so that i could go on with my work but then i have been getting a result like this : 33: SRR192339.sra empty format: txt, database: ?https://main.g2.bx.psu.edu/datasets/543f7c4f13f23152/edit Info: The uploaded binary file contains inappropriate content This has been the case with almost all the files that i have been trying to upload . Please help me with this and i would be greatful if you could direct me to the right person who can help me sort this matter out . Thanking you Pranathi Pappu -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] help for alternative splicing with RNA-seq analysis
Hello Jianguang, The RNA-seq tutorial was just updated: http://main.g2.bx.psu.edu/u/jeremy/p/galaxy-rna-seq-analysis-exercise Hopefully this helps, Jen Galaxy team On 8/9/12 10:41 AM, Du, Jianguang wrote: I have RNA-seq datasets of several cell types. I want to compare alternative splicing events between diffrent cell types. Can anyone show me the protocol/workflow or direct me to the tutorial? Thanks. Jianguang ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Help with Summary Statistics
Hello, I am attempting to use Galaxy to calculate the mean sequence read length and identify the range of read lengths for my 454 data. The data has already been organized and sorted by species. The format of the data is as follows: HD4AU5D01BHBCQCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC HD4AU5D01A093MCTCTGTCGCTCTGTCTCTCTTCTCTCTCTCTCTCTCT etc...for each species I have attempted to use the Summary Statistics button, however it appears to only be for numerical data and not sequence data. Is this tool/task available via Galaxy? Thank you, Dominique Cowart User name: dac330 ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Help with Summary Statistics
On Thu, Aug 2, 2012 at 7:50 PM, D. A. Cowart dac...@psu.edu wrote: Hello, I am attempting to use Galaxy to calculate the mean sequence read length and identify the range of read lengths for my 454 data. The data has already been organized and sorted by species. The format of the data is as follows: That was probably FASTA format (but mangled in the email). I have attempted to use the Summary Statistics button, however it appears to only be for numerical data and not sequence data. Is this tool/task available via Galaxy? Use the Compute sequence length tool to compute the read lengths, and then you should be able to compute some statistics about the lengths. Peter ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Help!!! cuffdiff log2 value
Hi Jiwen, As far as I know, this is possible. The CuffDiff log2 value is defined here: http://cufflinks.cbcb.umd.edu/manual.html#gene_exp_diff 7 FPKMx 8.01089 FPKM of the gene in sample x 8 FPKMy 8.551545 FPKM of the gene in sample y 9 log2(FPKMy/FPKMx) 0.06531 The (base 2) log of the fold change y/x And log(2) in general (including a graph, which can help with visualizing) is described here (although the web is full if similar): http://en.wikipedia.org/wiki/Logarithm I can see that this same Q on seqanswers.com recieved pretty much the same answer (in brief! http://seqanswers.com/forums/showthread.php?t=19558), so I think you are safe using the data as it as generated. Taking a look at the inputs would be advised if the results were unexpected. If you do still have concerns about the log(2) calculation, asking the tool authors directly (if you have't done so already) at tophat.cuffli...@gmail.com is always an option, to tripple check. Best, Jen Galaxy team On 4/26/12 7:48 AM, 杨继文 wrote: Hi, I am analyzing my RNA-Seq data. After running cuffdiff, I got a list of differentially expressed transcrpts or genes. As far as I know, log2 value = fold change. However, there are minus values. Is this possible?? log2 value can not be minus. Did I miss something?? Looking forward to your help. Thanks in advance. Best Jiwen 网易Lofter,专注兴趣,分享创作! http://www.lofter.com ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Help!!! cuffdiff log2 value
I think the sign is to show if it is x-fold more than the first condition (+) or x-fold less than the first condition (-). A regular fold would give you values from 1-whatever if sample 2 is more than sample 1, and a fraction (0-1) if sample 1 is expressed more than sample 2. The log lets you get both on the same scale, so that 2 means (on log2 scale) four-fold upregulated, and -2 means four-fold downregulated. FPKM x FPKM y y/x log(y/x) 1 2 2 1 1 0.5 0.5 -1 On 10/05/2012 19:00, Jennifer Jackson wrote: Hi Jiwen, As far as I know, this is possible. The CuffDiff log2 value is defined here: http://cufflinks.cbcb.umd.edu/manual.html#gene_exp_diff 7 FPKMx 8.01089 FPKM of the gene in sample x 8 FPKMy 8.551545 FPKM of the gene in sample y 9 log2(FPKMy/FPKMx) 0.06531 The (base 2) log of the fold change y/x And log(2) in general (including a graph, which can help with visualizing) is described here (although the web is full if similar): http://en.wikipedia.org/wiki/Logarithm I can see that this same Q on seqanswers.com recieved pretty much the same answer (in brief! http://seqanswers.com/forums/showthread.php?t=19558), so I think you are safe using the data as it as generated. Taking a look at the inputs would be advised if the results were unexpected. If you do still have concerns about the log(2) calculation, asking the tool authors directly (if you have't done so already) at tophat.cuffli...@gmail.com is always an option, to tripple check. Best, Jen Galaxy team On 4/26/12 7:48 AM, 杨继文 wrote: Hi, I am analyzing my RNA-Seq data. After running cuffdiff, I got a list of differentially expressed transcrpts or genes. As far as I know, log2 value = fold change. However, there are minus values. Is this possible?? log2 value can not be minus. Did I miss something?? Looking forward to your help. Thanks in advance. Best Jiwen 网易Lofter,专注兴趣,分享创作! http://www.lofter.com ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using "reply all" in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Help!!! cuffdiff log2 value
Hi Noa, This is it exactly - thanks for adding in the interpretation! Jen On 5/10/12 11:54 AM, Noa Sher wrote: I think the sign is to show if it is x-fold more than the first condition (+) or x-fold less than the first condition (-). A regular fold would give you values from 1-whatever if sample 2 is more than sample 1, and a fraction (0-1) if sample 1 is expressed more than sample 2. The log lets you get both on the same scale, so that 2 means (on log2 scale) four-fold upregulated, and -2 means four-fold downregulated. FPKM x FPKM y y/x log(y/x) 1 2 2 1 1 0.5 0.5 -1 On 10/05/2012 19:00, Jennifer Jackson wrote: Hi Jiwen, As far as I know, this is possible. The CuffDiff log2 value is defined here: http://cufflinks.cbcb.umd.edu/manual.html#gene_exp_diff 7 FPKMx 8.01089 FPKM of the gene in sample x 8 FPKMy 8.551545 FPKM of the gene in sample y 9 log2(FPKMy/FPKMx) 0.06531 The (base 2) log of the fold change y/x And log(2) in general (including a graph, which can help with visualizing) is described here (although the web is full if similar): http://en.wikipedia.org/wiki/Logarithm I can see that this same Q on seqanswers.com recieved pretty much the same answer (in brief! http://seqanswers.com/forums/showthread.php?t=19558), so I think you are safe using the data as it as generated. Taking a look at the inputs would be advised if the results were unexpected. If you do still have concerns about the log(2) calculation, asking the tool authors directly (if you have't done so already) at tophat.cuffli...@gmail.com is always an option, to tripple check. Best, Jen Galaxy team On 4/26/12 7:48 AM, 杨继文 wrote: Hi, I am analyzing my RNA-Seq data. After running cuffdiff, I got a list of differentially expressed transcrpts or genes. As far as I know, log2 value = fold change. However, there are minus values. Is this possible?? log2 value can not be minus. Did I miss something?? Looking forward to your help. Thanks in advance. Best Jiwen 网易Lofter,专注兴趣,分享创作! http://www.lofter.com ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Help on installing cutadapt
Hello Tilahun, Are you logged into your Galaxy instance UI using your admin account? This will display the Admin menu. Admin permissions are set up in the universe_wsgi.ini file: # -- Users and Security other items # Administrative users - set this to a comma-separated list of valid Galaxy # users (email addresses). These users will have access to the Admin section # of the server, and will have access to create users, groups, roles, # libraries, and more. For more information, see: # http://wiki.g2.bx.psu.edu/Admin/Interface #admin_users = None Hopefully this solves the issue. Going forward, you'll probably find that the galaxy-...@bx.psu.edu mailing list is the most helpful for local install questions: http://wiki.g2.bx.psu.edu/Support#Mailing_Lists Best, Jen Galaxy team On 5/8/12 2:10 PM, Tilahun Abebe wrote: Hi Galaxy users, I tried to install cutadapt for sequence trimming on a local Galaxy instance. I successfully installed Galaxy as an administrator. However, when Galaxy starts, I don't see the administrator option in the top menu bar with the Analyze Data, Workflow, Shared Data, Visualization, Help, and User. It looks like the only way I can install cutadapt is with an administrator option. Any suggestion how I can include the administrator option in the menu? Thanks for your help. Tilahun ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Help!! Tophat paired end reads
Hi Jennifer, This is a subject I'm interested in. I wonder if you could share a workflow to estimate percentage of reads mapping to for example exomes(I can get the coordinates for a GFF dataset). I have a mapping result for RNA-seq data and by looking in the browser, it seems to also have a lot of reads mapping outside of exomes, but I would like to put numbers on it. Thanks, Carlos P.D. I'm trying now to get GATK's 'Depth of Coverage' to work, but I'm having some issues with it. Is there any other options in Galaxy? On Mon, Apr 16, 2012 at 12:27 AM, Jennifer Jackson j...@bx.psu.edu wrote: Hi Jiwen, The bioinformatics part of your analysis sounds as if it went fine, so that is good news. This list may not be the best place to get feedback about library construction methods, but we can see who has help to offer. I did a quick search myself and found this recent publication that includes a comparison of rRNA depletion methods with mapping profiles: http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0027288 Best, Jen Galaxy team On 4/15/12 8:24 AM, 杨继文 wrote: Hi, I am very confused by my mapping. Please help me figure out what's wrong with my operation. I got Illumina Hiseq 2000 paired end reads (mouse), and I used Tophat to map these reads. After mapping, I used IGV to have a look at the mapping. I can see that some of the reads fall into exons or span exons (splice junction). These reads seem to fit very well. However, I can also see a lot reads mapped to non-coding region. Are these reads from pre-mRNA? or my mapping was wrong? Did anybody have similar experience?? Furthermore, I can see huge enrichment of reads in 3' UTR (much much more than the coding region). Is this normal? Is this caused by the rRNA depletion method ? Looking forward to your reply Jiwen ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Help!! Tophat paired end reads
Hi, I am very confused by my mapping. Please help me figure out what's wrong with my operation. I got Illumina Hiseq 2000 paired end reads (mouse), and I used Tophat to map these reads. After mapping, I used IGV to have a look at the mapping. I can see that some of the reads fall into exons or span exons (splice junction). These reads seem to fit very well. However, I can also see a lot reads mapped to non-coding region. Are these reads from pre-mRNA? or my mapping was wrong? Did anybody have similar experience?? Furthermore, I can see huge enrichment of reads in 3' UTR (much much more than the coding region). Is this normal? Is this caused by the rRNA depletion method ? Looking forward to your reply Jiwen ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Help!! Tophat paired end reads
Hi Jiwen, The bioinformatics part of your analysis sounds as if it went fine, so that is good news. This list may not be the best place to get feedback about library construction methods, but we can see who has help to offer. I did a quick search myself and found this recent publication that includes a comparison of rRNA depletion methods with mapping profiles: http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0027288 Best, Jen Galaxy team On 4/15/12 8:24 AM, 杨继文 wrote: Hi, I am very confused by my mapping. Please help me figure out what's wrong with my operation. I got Illumina Hiseq 2000 paired end reads (mouse), and I used Tophat to map these reads. After mapping, I used IGV to have a look at the mapping. I can see that some of the reads fall into exons or span exons (splice junction). These reads seem to fit very well. However, I can also see a lot reads mapped to non-coding region. Are these reads from pre-mRNA? or my mapping was wrong? Did anybody have similar experience?? Furthermore, I can see huge enrichment of reads in 3' UTR (much much more than the coding region). Is this normal? Is this caused by the rRNA depletion method ? Looking forward to your reply Jiwen ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://galaxyproject.org ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Help need in troubleshooting cufflinks
Hi Team, This is Vijay from ELogic Technologies Pvt Ltd, Bangalore, India. 1. Using Galaxy local 2. NA 3. Galaxy was downloaded using the tar files 4. NA 5. When i tried to install Cufflinks into my system i am getting the following error. In file included from hits.h:21:0, from abundances.h:20, from differential.cpp:17: common.h: At global scope: common.h:25:25: error: ‘boost::BOOST_FOREACH’ has not been declared In file included from differential.h:29:0, from differential.cpp:18: replicates.h: In member function ‘bool ReplicatedBundleFactory::next_bundle(HitBundle)’: replicates.h:141:50: warning: unused variable ‘s2’ [-Wunused-variable] differential.cpp: In member function ‘void TestLauncher::perform_testing(std::vectorboost::shared_ptrSampleAbundances )’: differential.cpp:111:31: warning: unused variable ‘s2’ [-Wunused-variable] differential.cpp: In function ‘void sample_abundance_worker(const string, SampleAbundances, HitBundle*, bool, bool)’: differential.cpp:704:41: warning: comparison between signed and unsigned integer expressions [-Wsign-compare] make[2]: *** [differential.o] Error 1 make[2]: Leaving directory `/home/binet/Downloads/cufflinks-1.2.0/src' make[1]: *** [all-recursive] Error 1 make[1]: Leaving directory `/home/binet/Downloads/cufflinks-1.2.0' make: *** [all] Error 2 Even i have tried with various versions of cufflinks but i am getting the same error. Please kindly help me in getting out of this error. Thanks and Regards Vijay ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Help
Hi, I read on Readme for MACS that: For the experiment with several replicates, it is recommended to concatenate several ChIP-seq treatment files into a single file. Now, I have illumina ChipSeq data: two files for IP samples and two files for Control samples. Is It right to use Concatenate datasets (text manipulation) and then use MACS for the peaks calling? Thank you so much. Giuseppe ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Help with sam to bam (Zachary A Lewis)
Hi Zach, Would you have time to send this in as a bug report so that we can take a closer look? Format problems are likely the issue, but this can be double checked. To report as a bug, click on the green bug icon in the error dataset's box in your history. If your Galaxy account uses a different email, just note that in the comments so the two questions can be linked. Thanks! Jen Galaxy team On 9/14/11 11:01 AM, Pandey, Ashutosh wrote: Message: 1 Date: Tue, 13 Sep 2011 18:32:43 + From: Zachary A Lewiszle...@uga.edu To: galaxy-user@lists.bx.psu.edugalaxy-user@lists.bx.psu.edu Subject: [galaxy-user] Help with sam to bam Message-ID:ae8e036c-cbd3-46f9-b5a4-0615cd806...@uga.edu Content-Type: text/plain; charset=us-ascii Hi, I was wondering if someone could help me with an error message I'm getting after performing a sam to bam conversion in galaxy. I've used Bowtie to map sequence reads to a custom fasta file corresponding to one chromosome in my organism. The mapping seems to work fine, but when I attempt a sam to bam conversion, I receive the folowing error message: An error occurred running this job: Samtools Version: 0.1.12 (r862) Error creating indexes from reference (/galaxy/main_database/files/002/977/dataset_2977193.dat), [fai_build_core] line length exceeds 65535 in sequence 'LGVII'. Segmentation fault Any help would be appreciated. Thanks, Zack Hi Zack, I got a similar problem but I am not sure if you have the same problem. My problem was due to use of different chromosome symbol by reference fasta file and the SAM file. May be you are using chr2 in SAM file and 2 in reference file or vice-versa. Converting chromosome symbol would be easy for reference fasta file. Thanks -Ash ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/ -- Jennifer Jackson http://usegalaxy.org http://galaxyproject.org/Support ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
[galaxy-user] Help with sam to bam
Hi, I was wondering if someone could help me with an error message I'm getting after performing a sam to bam conversion in galaxy. I've used Bowtie to map sequence reads to a custom fasta file corresponding to one chromosome in my organism. The mapping seems to work fine, but when I attempt a sam to bam conversion, I receive the folowing error message: An error occurred running this job: Samtools Version: 0.1.12 (r862) Error creating indexes from reference (/galaxy/main_database/files/002/977/dataset_2977193.dat), [fai_build_core] line length exceeds 65535 in sequence 'LGVII'. Segmentation fault Any help would be appreciated. Thanks, Zack ___ The Galaxy User list should be used for the discussion of Galaxy analysis and other features on the public server at usegalaxy.org. Please keep all replies on the list by using reply all in your mail client. For discussion of local Galaxy instances and the Galaxy source code, please use the Galaxy Development list: http://lists.bx.psu.edu/listinfo/galaxy-dev To manage your subscriptions to this and other Galaxy lists, please use the interface at: http://lists.bx.psu.edu/
Re: [galaxy-user] Help!!!!!! with Galaxy Cloud!!!!!
Hello again, So I am able to see all of the .dat files in /mnt/galaxyData. What commands can I use to download a file to my HD? Also, what program should I use to open the .dat file? Thanks again, Mike --- On Wed, 4/13/11, Enis Afgan eaf...@emory.edu wrote: From: Enis Afgan eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: Mike Dufault dufau...@yahoo.com Cc: galaxy-u...@bx.psu.edu Date: Wednesday, April 13, 2011, 11:15 PM Hi Mike, Once the given EBS volume is attached and mounted, all of the data should be in /mnt/galaxyData/files/000/This assumes the file system is mounted to /mnt/galaxyData, which is where it would get mounted to automatically by cloudman on cluster instantiation. Enis On Wed, Apr 13, 2011 at 9:00 PM, Mike Dufault dufau...@yahoo.com wrote: Hi Enis, I started to use the terminal to check to see if the job was running, but it stopped successfully at the same time. Thanks again for helping me to complete the run. Now I have an additional issue. I wanted to save my BAM file, but I kept getting an error. I think the error was because it was too large to send (4.1GB). So I saved what I could to my local HD and terminated the cluster. My EBS volume is 200GB and persisted after the cluster was terminated. I assume that my BAM file resides somewhere in the EBS volume. I started a new Unix cluster and attached the EBS to that cluster. I also established an ssh to the Unis cluster but I do not know where to find the BAM file. Do you know how I can access the BAM file so that I can transfer it to my local HD? Thanks, Mike --- On Wed, 4/13/11, Enis Afgan eaf...@emory.edu wrote: From: Enis Afgan eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: vasu punj pu...@yahoo.com Cc: galaxy-u...@bx.psu.edu Date: Wednesday, April 13, 2011, 10:01 AM Hi Vasu, I am not sure I understand your question but the general instructions on how to get started and use Galaxy on the cloud (i.e., Cloudman) are available at usegalaxy.org/cloud Let us know if you that page does not answer your questions, Enis On Wed, Apr 13, 2011 at 9:40 AM, vasu punj pu...@yahoo.com wrote: I was wondering if there are instructions how can I run the Galaxy on CloudConsole, Indeed first I want to know how Galaxy is established on console? Can someone direct me to the instructions please. Thanks. --- On Tue, 4/12/11, Enis Afgan eaf...@emory.edu wrote: From: Enis Afgan eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: Mike Dufault dufau...@yahoo.com Cc: galaxy-u...@bx.psu.edu Date: Tuesday, April 12, 2011, 9:31 PM Galaxy has the functionality to recover any jobs that were running after it's restarted so it is quite possible to for the job to still be running. In addition, from the cloudman console, it appears that at least one instance is pretty heavily loaded so that can also mean that the job is still running. However, without actually accessing the instance through the command line and checking the status of the job queue, it is not possible to tell if the job is - actually running. Do you know how to do that? It's just a few commands in the terminal: - access the instance [local]$ ssh -i path to the private key you downloaded from AWS when you created a key pair ubuntu@instance public DNS - become galaxy user [ec2]$ sudo su galaxy - list any running jobs [ec2]$ qstat If that command returns a list of jobs and the jobs are in stare 'r' (running), the job is still running; otherwise, no. Let me know how it goes, Enis On Tue, Apr 12, 2011 at 9:49 PM, Mike Dufault dufau...@yahoo.com wrote: Hi Enis, THANK YOU!!! I see that my filter pileup on data step is running. Is this the same analysis that was running before or did it relauch when you restarted Galaxy? I just don't know if the analysis would be compromised. Thanks again to you and the whole Galaxy team. Best, Mike --- On Tue, 4/12/11, Enis Afgan eaf...@emory.edu wrote: From: Enis Afgan eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: Mike Dufault dufau...@yahoo.com Cc: Anton Nekrutenko an...@bx.psu.edu, galaxy-u...@bx.psu.edu Date: Tuesday, April 12, 2011, 9:16 PM Ahh, for some reason cloudman is thinking Galaxy is not 'running' but still 'starting' and has thus not enabled the given button. To access the analysis, in your browser, just delete the '/cloud' part of the URL and that should load Galaxy. Sorry about the confusion, Enis On Tue, Apr 12, 2011 at 9:12 PM, Mike Dufault dufau...@yahoo.com wrote: Hi Enis, Thanks for looking into this. From the Galaxy Cloudman Console, I can see that it was restarted from the log (thanks), but the Access Galaxy choice is still grayed out and I don't know how to access the Analysis window. Is there a way back into my analysis? Thanks, Mike --- On Tue, 4/12/11, Enis Afgan eaf
Re: [galaxy-user] Help!!!!!! with Galaxy Cloud!!!!!
Hi Mike, You should be able to download the desired file(s) directly from Galaxy by expanding the desired history item and then clicking the 'disk' (i.e., download) icon. Alternatively, if you want to copy the file by hand directly from the file system on the instance, the following is the command to execute (note that the command is executed from your local machine): scp -i path to your AWS key pair file ubuntu@instance public DNS:/mnt/galaxyData/files/000/file name . (also, note the '.' at the end of the command) This command will copy the remote file to your local machine and it will put it in your current directory. Once downloaded, the file can probably be opened with any text editor (unless it's a binary file, in which case it will have to be opened with the appropriate tool that can read the given file format). Enis On Fri, Apr 15, 2011 at 12:32 AM, Mike Dufault dufau...@yahoo.com wrote: Hello again, So I am able to see all of the .dat files in /mnt/galaxyData. What commands can I use to download a file to my HD? Also, what program should I use to open the .dat file? Thanks again, Mike --- On *Wed, 4/13/11, Enis Afgan eaf...@emory.edu* wrote: From: Enis Afgan eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: Mike Dufault dufau...@yahoo.com Cc: galaxy-u...@bx.psu.edu Date: Wednesday, April 13, 2011, 11:15 PM Hi Mike, Once the given EBS volume is attached and mounted, all of the data should be in /mnt/galaxyData/files/000/ This assumes the file system is mounted to /mnt/galaxyData, which is where it would get mounted to automatically by cloudman on cluster instantiation. Enis On Wed, Apr 13, 2011 at 9:00 PM, Mike Dufault dufau...@yahoo.comhttp://mc/compose?to=dufau...@yahoo.com wrote: Hi Enis, I started to use the terminal to check to see if the job was running, but it stopped successfully at the same time. Thanks again for helping me to complete the run. Now I have an additional issue. I wanted to save my BAM file, but I kept getting an error. I think the error was because it was too large to send (4.1GB). So I saved what I could to my local HD and terminated the cluster. My EBS volume is 200GB and persisted after the cluster was terminated. I assume that my BAM file resides somewhere in the EBS volume. I started a new Unix cluster and attached the EBS to that cluster. I also established an ssh to the Unis cluster but I do not know where to find the BAM file. Do you know how I can access the BAM file so that I can transfer it to my local HD? Thanks, Mike --- On *Wed, 4/13/11, Enis Afgan eaf...@emory.eduhttp://mc/compose?to=eaf...@emory.edu * wrote: From: Enis Afgan eaf...@emory.edu http://mc/compose?to=eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: vasu punj pu...@yahoo.com http://mc/compose?to=pu...@yahoo.com Cc: galaxy-u...@bx.psu.edu http://mc/compose?to=galaxy-u...@bx.psu.edu Date: Wednesday, April 13, 2011, 10:01 AM Hi Vasu, I am not sure I understand your question but the general instructions on how to get started and use Galaxy on the cloud (i.e., Cloudman) are available at usegalaxy.org/cloud Let us know if you that page does not answer your questions, Enis On Wed, Apr 13, 2011 at 9:40 AM, vasu punj pu...@yahoo.comhttp://us.mc1137.mail.yahoo.com/mc/compose?to=pu...@yahoo.com wrote: I was wondering if there are instructions how can I run the Galaxy on CloudConsole, Indeed first I want to know how Galaxy is established on console? Can someone direct me to the instructions please. Thanks. --- On *Tue, 4/12/11, Enis Afgan eaf...@emory.eduhttp://us.mc1137.mail.yahoo.com/mc/compose?to=eaf...@emory.edu * wrote: From: Enis Afgan eaf...@emory.eduhttp://us.mc1137.mail.yahoo.com/mc/compose?to=eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: Mike Dufault dufau...@yahoo.comhttp://us.mc1137.mail.yahoo.com/mc/compose?to=dufau...@yahoo.com Cc: galaxy-u...@bx.psu.eduhttp://us.mc1137.mail.yahoo.com/mc/compose?to=galaxy-u...@bx.psu.edu Date: Tuesday, April 12, 2011, 9:31 PM Galaxy has the functionality to recover any jobs that were running after it's restarted so it is quite possible to for the job to still be running. In addition, from the cloudman console, it appears that at least one instance is pretty heavily loaded so that can also mean that the job is still running. However, without actually accessing the instance through the command line and checking the status of the job queue, it is not possible to tell if the job is - actually running. Do you know how to do that? It's just a few commands in the terminal: - access the instance [local]$ ssh -i path to the private key you downloaded from AWS when you created a key pair ubuntu@instance public DNS - become galaxy user [ec2]$ sudo su galaxy - list any running jobs [ec2]$ qstat If that command returns a list of jobs
Re: [galaxy-user] Help!!!!!! with Galaxy Cloud!!!!!
I don't think you'll need to convert the file other than maybe renaming the extension (mv filename.dat filename.bam) because Galaxy just adds that same extension to each file while the metadata that it keeps tell it which format the file is in. Just try opening the file up using the tool you were planning to use and it should work. Enis On Fri, Apr 15, 2011 at 8:49 AM, Mike Dufault dufau...@yahoo.com wrote: Hi Enis, With the exception of the BAM file (4.1Gb) I have been able to download everything that I have tried using the disk from the history panel. I think the 4.1Gb file is just too large because I keep getting a memory error. Since I am still new to the whole AWS-EC2 set-up, I have not fooled around to much with the instance set up. I have followed the screen-cast give by Anton. Perhaps I need to change the memory settings when I create the instance. It seems it would be better if I could download if from the disk icon since then it would be in the correct BAM format. Anyway, I will try scp directions that you have provided and find out how to convert from .dat back to (or somehow extract the) BAM file once I get it to my local machine. Each step is one step closer. Thanks again, Mike --- On *Fri, 4/15/11, Enis Afgan eaf...@emory.edu* wrote: From: Enis Afgan eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: Mike Dufault dufau...@yahoo.com Cc: galaxy-u...@bx.psu.edu Date: Friday, April 15, 2011, 8:21 AM Hi Mike, You should be able to download the desired file(s) directly from Galaxy by expanding the desired history item and then clicking the 'disk' (i.e., download) icon. Alternatively, if you want to copy the file by hand directly from the file system on the instance, the following is the command to execute (note that the command is executed from your local machine): scp -i path to your AWS key pair file ubuntu@instance public DNS:/mnt/galaxyData/files/000/file name . (also, note the '.' at the end of the command) This command will copy the remote file to your local machine and it will put it in your current directory. Once downloaded, the file can probably be opened with any text editor (unless it's a binary file, in which case it will have to be opened with the appropriate tool that can read the given file format). Enis On Fri, Apr 15, 2011 at 12:32 AM, Mike Dufault dufau...@yahoo.comhttp://mc/compose?to=dufau...@yahoo.com wrote: Hello again, So I am able to see all of the .dat files in /mnt/galaxyData. What commands can I use to download a file to my HD? Also, what program should I use to open the .dat file? Thanks again, Mike --- On *Wed, 4/13/11, Enis Afgan eaf...@emory.eduhttp://mc/compose?to=eaf...@emory.edu * wrote: From: Enis Afgan eaf...@emory.edu http://mc/compose?to=eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: Mike Dufault dufau...@yahoo.comhttp://mc/compose?to=dufau...@yahoo.com Cc: galaxy-u...@bx.psu.edu http://mc/compose?to=galaxy-u...@bx.psu.edu Date: Wednesday, April 13, 2011, 11:15 PM Hi Mike, Once the given EBS volume is attached and mounted, all of the data should be in /mnt/galaxyData/files/000/ This assumes the file system is mounted to /mnt/galaxyData, which is where it would get mounted to automatically by cloudman on cluster instantiation. Enis On Wed, Apr 13, 2011 at 9:00 PM, Mike Dufault dufau...@yahoo.comhttp://mc/compose?to=dufau...@yahoo.com wrote: Hi Enis, I started to use the terminal to check to see if the job was running, but it stopped successfully at the same time. Thanks again for helping me to complete the run. Now I have an additional issue. I wanted to save my BAM file, but I kept getting an error. I think the error was because it was too large to send (4.1GB). So I saved what I could to my local HD and terminated the cluster. My EBS volume is 200GB and persisted after the cluster was terminated. I assume that my BAM file resides somewhere in the EBS volume. I started a new Unix cluster and attached the EBS to that cluster. I also established an ssh to the Unis cluster but I do not know where to find the BAM file. Do you know how I can access the BAM file so that I can transfer it to my local HD? Thanks, Mike --- On *Wed, 4/13/11, Enis Afgan eaf...@emory.eduhttp://mc/compose?to=eaf...@emory.edu * wrote: From: Enis Afgan eaf...@emory.edu http://mc/compose?to=eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: vasu punj pu...@yahoo.com http://mc/compose?to=pu...@yahoo.com Cc: galaxy-u...@bx.psu.edu http://mc/compose?to=galaxy-u...@bx.psu.edu Date: Wednesday, April 13, 2011, 10:01 AM Hi Vasu, I am not sure I understand your question but the general instructions on how to get started and use Galaxy on the cloud (i.e., Cloudman) are available at usegalaxy.org/cloud Let us know if you that page does not answer your questions
Re: [galaxy-user] Help!!!!!! with Galaxy Cloud!!!!!
Hello Galaxy Staff, My data has been running on the Amazon EC2 for just over 24hrs. I have not closed any windows and my Exome analysis made it all the way through to filter on Pile up. I have two tabs for this instance. One is the Galaxy Cloudman Console and the other is the tab where I perform the analysis, load data, history etc. Anyway, I went to add a step to the work flow and the screen Welcome Galaxy to the Cloud screen along with the information There is no Galaxy instance running on this host, or the Galaxy instance is not responding. To manage Galaxy on this host, please use the Cloud Console. What happened??? When I go back to the Galaxy Cloudman Console, it shows that my instance is still running along with the four cores, the Cluster log is below. AWS also shows that my instance is running. Will the work flow finish? Can I get my data? How? I tried to re-access the analysis page by selecting Access Galaxy from the Galaxy Cloudman Console but it sends me to the same Welcome page. Is there a way to get back into the analysis page? Please help!!! Thanks, Mike The cluster log shows: 13:05:24 - Master starting13:05:25 - Completed initial cluster configuration.13:05:33 - Starting service 'SGE'13:05:48 - Configuring SGE...13:05:56 - Successfully setup SGE; configuring SGE13:05:57 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:05:57 - Saved file 'cm_boot.py' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:05:57 - Saved file 'cm.tar.gz' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:05:57 - Problem connecting to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3', attempt 1/513:05:59 - Saved file 'Fam122261.clusterName' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:06:24 - Initializing a 'Galaxy' cluster.13:06:24 - Retrieved file 'snaps.yaml' from bucket 'cloudman' to 'cm_snaps.yaml'.13:06:41 - Adding 3 instance(s)...13:07:02 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:07:38 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:07:38 - Saved file 'universe_wsgi.ini.cloud' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:07:38 - Saved file 'tool_conf.xml.cloud' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:07:48 - Error mounting file system '/mnt/galaxyData' from '/dev/sdg3', running command '/bin/mount /dev/sdg3 /mnt/galaxyData' returned code '32' and following stderr: 'mount: you must specify the filesystem type '13:07:52 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:07:52 - Starting service 'Postgres'13:07:52 - PostgreSQL data directory '/mnt/galaxyData/pgsql/data' does not exist (yet?)13:07:52 - Configuring PostgreSQL with a database for Galaxy...13:08:05 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:08:05 - Starting service 'Galaxy'13:08:05 - Galaxy daemon not running.13:08:05 - Galaxy service state changed from 'Starting' to 'Error'13:08:05 - Setting up Galaxy application13:08:05 - Retrieved file 'universe_wsgi.ini.cloud' from bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' to '/mnt/galaxyTools/galaxy-central/universe_wsgi.ini'.13:08:05 - Retrieved file 'tool_conf.xml.cloud' from bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' to '/mnt/galaxyTools/galaxy-central/tool_conf.xml'.13:08:05 - Retrieved file 'tool_data_table_conf.xml.cloud' from bucket 'cloudman' to '/mnt/galaxyTools/galaxy-central/tool_data_table_conf.xml.cloud'.13:08:05 - Starting Galaxy...13:08:09 - Galaxy service state changed from 'Error' to 'Starting'13:08:09 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:08:09 - Saved file 'tool_data_table_conf.xml.cloud' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:08:28 - Instance 'i-e46f0a8b' reported alive13:08:28 - Successfully generated root user's public key.13:08:28 - Sent master public key to worker instance 'i-e46f0a8b'.13:08:28 - Instance 'i-e26f0a8d' reported alive13:08:28 - Sent master public key to worker instance 'i-e26f0a8d'.13:08:33 - Instance 'i-e06f0a8f' reported alive13:08:33 - Sent master public key to worker instance 'i-e06f0a8f'.13:08:33 - Adding instance i-e46f0a8b to SGE Execution Host list13:08:44 - Successfully added instance 'i-e46f0a8b' to SGE13:08:44 - Waiting on worker instance 'i-e46f0a8b' to configure itself...13:08:44 - Instance 'i-e26f0a8d' already in SGE's @allhosts13:08:44 - Waiting on worker instance 'i-e26f0a8d' to configure itself...13:08:45 - Instance 'i-e06f0a8f' already in SGE's @allhosts13:08:45 - Waiting on worker instance 'i-e06f0a8f' to configure itself...13:08:50 - Instance 'i-e46f0a8b' ready13:09:27 - Galaxy service state changed from 'Starting' to 'Running'22:38:18 - Found '3' idle instances; trying to remove '2'22:38:18 - Specific termination of instance 'i-e26f0a8d' requested.22:38:18 - Removing instance 'i-e26f0a8d'
Re: [galaxy-user] Help!!!!!! with Galaxy Cloud!!!!!
Hi Mike, Try accessing your Galaxy instance now. It should be ok. The link in your email contained the IP for your instance so I took the liberty of restarting Galaxy and that brought it back up. There seems to have been an issue with Galaxy accessing its database and that resulted in Galaxy crashing. We'll look into why that happened in the first place but should be ok now. Let me know if you have any more trouble, Enis On Tue, Apr 12, 2011 at 2:49 PM, Mike Dufault dufau...@yahoo.com wrote: Hello Galaxy Staff, My data has been running on the Amazon EC2 for just over 24hrs. I have not closed any windows and my Exome analysis made it all the way through to filter on Pile up. I have two tabs for this instance. One is the Galaxy Cloudman Console and the other is the tab where I perform the analysis, load data, history etc. Anyway, I went to add a step to the work flow and the screen Welcome Galaxy to the Cloud screen along with the information There is no Galaxy instance running on this host, or the Galaxy instance is not responding. To manage Galaxy on this host, please use the Cloud Consolehttp://ec2-67-202-55-176.compute-1.amazonaws.com/cloud . What happened??? When I go back to the Galaxy Cloudman Console, it shows that my instance is still running along with the four cores, the Cluster log is below. AWS also shows that my instance is running. Will the work flow finish? Can I get my data? How? I tried to re-access the analysis page by selecting Access Galaxy from the Galaxy Cloudman Console but it sends me to the same Welcome page. Is there a way to get back into the analysis page? Please help!!! Thanks, Mike The cluster log shows: - 13:05:24 - Master starting - 13:05:25 - Completed initial cluster configuration. - 13:05:33 - Starting service 'SGE' - 13:05:48 - Configuring SGE... - 13:05:56 - Successfully setup SGE; configuring SGE - 13:05:57 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' - 13:05:57 - Saved file 'cm_boot.py' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' - 13:05:57 - Saved file 'cm.tar.gz' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' - 13:05:57 - Problem connecting to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3', attempt 1/5 - 13:05:59 - Saved file 'Fam122261.clusterName' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' - 13:06:24 - Initializing a 'Galaxy' cluster. - 13:06:24 - Retrieved file 'snaps.yaml' from bucket 'cloudman' to 'cm_snaps.yaml'. - 13:06:41 - Adding 3 instance(s)... - 13:07:02 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' - 13:07:38 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' - 13:07:38 - Saved file 'universe_wsgi.ini.cloud' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' - 13:07:38 - Saved file 'tool_conf.xml.cloud' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' - 13:07:48 - Error mounting file system '/mnt/galaxyData' from '/dev/sdg3', running command '/bin/mount /dev/sdg3 /mnt/galaxyData' returned code '32' and following stderr: 'mount: you must specify the filesystem type ' - 13:07:52 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' - 13:07:52 - Starting service 'Postgres' - 13:07:52 - PostgreSQL data directory '/mnt/galaxyData/pgsql/data' does not exist (yet?) - 13:07:52 - Configuring PostgreSQL with a database for Galaxy... - 13:08:05 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' - 13:08:05 - Starting service 'Galaxy' - 13:08:05 - Galaxy daemon not running. - 13:08:05 - Galaxy service state changed from 'Starting' to 'Error' - 13:08:05 - Setting up Galaxy application - 13:08:05 - Retrieved file 'universe_wsgi.ini.cloud' from bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' to '/mnt/galaxyTools/galaxy-central/universe_wsgi.ini'. - 13:08:05 - Retrieved file 'tool_conf.xml.cloud' from bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' to '/mnt/galaxyTools/galaxy-central/tool_conf.xml'. - 13:08:05 - Retrieved file 'tool_data_table_conf.xml.cloud' from bucket 'cloudman' to '/mnt/galaxyTools/galaxy-central/tool_data_table_conf.xml.cloud'. - 13:08:05 - Starting Galaxy... - 13:08:09 - Galaxy service state changed from 'Error' to 'Starting' - 13:08:09 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' - 13:08:09 - Saved file 'tool_data_table_conf.xml.cloud' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' - 13:08:28 - Instance 'i-e46f0a8b' reported alive - 13:08:28 - Successfully generated root user's public key. - 13:08:28 - Sent master public key to worker instance 'i-e46f0a8b'. - 13:08:28 - Instance 'i-e26f0a8d' reported alive - 13:08:28 - Sent master public key to
Re: [galaxy-user] Help!!!!!! with Galaxy Cloud!!!!!
Hi Enis, Thanks for looking into this. From the Galaxy Cloudman Console, I can see that it was restarted from the log (thanks), but the Access Galaxy choice is still grayed out and I don't know how to access the Analysis window. Is there a way back into my analysis? Thanks, Mike --- On Tue, 4/12/11, Enis Afgan eaf...@emory.edu wrote: From: Enis Afgan eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: Mike Dufault dufau...@yahoo.com Cc: Anton Nekrutenko an...@bx.psu.edu, galaxy-u...@bx.psu.edu Date: Tuesday, April 12, 2011, 8:55 PM Hi Mike, Try accessing your Galaxy instance now. It should be ok. The link in your email contained the IP for your instance so I took the liberty of restarting Galaxy and that brought it back up. There seems to have been an issue with Galaxy accessing its database and that resulted in Galaxy crashing. We'll look into why that happened in the first place but should be ok now. Let me know if you have any more trouble,Enis On Tue, Apr 12, 2011 at 2:49 PM, Mike Dufault dufau...@yahoo.com wrote: Hello Galaxy Staff, My data has been running on the Amazon EC2 for just over 24hrs. I have not closed any windows and my Exome analysis made it all the way through to filter on Pile up. I have two tabs for this instance. One is the Galaxy Cloudman Console and the other is the tab where I perform the analysis, load data, history etc. Anyway, I went to add a step to the work flow and the screen Welcome Galaxy to the Cloud screen along with the information There is no Galaxy instance running on this host, or the Galaxy instance is not responding. To manage Galaxy on this host, please use the Cloud Console. What happened??? When I go back to the Galaxy Cloudman Console, it shows that my instance is still running along with the four cores, the Cluster log is below. AWS also shows that my instance is running. Will the work flow finish? Can I get my data? How? I tried to re-access the analysis page by selecting Access Galaxy from the Galaxy Cloudman Console but it sends me to the same Welcome page. Is there a way to get back into the analysis page? Please help!!! Thanks, Mike The cluster log shows: 13:05:24 - Master starting13:05:25 - Completed initial cluster configuration.13:05:33 - Starting service 'SGE'13:05:48 - Configuring SGE...13:05:56 - Successfully setup SGE; configuring SGE 13:05:57 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:05:57 - Saved file 'cm_boot.py' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' 13:05:57 - Saved file 'cm.tar.gz' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:05:57 - Problem connecting to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3', attempt 1/513:05:59 - Saved file 'Fam122261.clusterName' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' 13:06:24 - Initializing a 'Galaxy' cluster.13:06:24 - Retrieved file 'snaps.yaml' from bucket 'cloudman' to 'cm_snaps.yaml'.13:06:41 - Adding 3 instance(s)... 13:07:02 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:07:38 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:07:38 - Saved file 'universe_wsgi.ini.cloud' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' 13:07:38 - Saved file 'tool_conf.xml.cloud' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:07:48 - Error mounting file system '/mnt/galaxyData' from '/dev/sdg3', running command '/bin/mount /dev/sdg3 /mnt/galaxyData' returned code '32' and following stderr: 'mount: you must specify the filesystem type '13:07:52 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:07:52 - Starting service 'Postgres'13:07:52 - PostgreSQL data directory '/mnt/galaxyData/pgsql/data' does not exist (yet?) 13:07:52 - Configuring PostgreSQL with a database for Galaxy...13:08:05 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:08:05 - Starting service 'Galaxy' 13:08:05 - Galaxy daemon not running.13:08:05 - Galaxy service state changed from 'Starting' to 'Error'13:08:05 - Setting up Galaxy application13:08:05 - Retrieved file 'universe_wsgi.ini.cloud' from bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' to '/mnt/galaxyTools/galaxy-central/universe_wsgi.ini'.13:08:05 - Retrieved file 'tool_conf.xml.cloud' from bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' to '/mnt/galaxyTools/galaxy-central/tool_conf.xml'.13:08:05 - Retrieved file 'tool_data_table_conf.xml.cloud' from bucket 'cloudman' to '/mnt/galaxyTools/galaxy-central/tool_data_table_conf.xml.cloud'.13:08:05 - Starting Galaxy...13:08:09 - Galaxy service state changed from 'Error' to 'Starting'13:08:09 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' 13:08:09 - Saved file 'tool_data_table_conf.xml.cloud' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:08:28 - Instance 'i-e46f0a8b
Re: [galaxy-user] Help!!!!!! with Galaxy Cloud!!!!!
Hi Enis, THANK YOU!!! I see that my filter pileup on data step is running. Is this the same analysis that was running before or did it relauch when you restarted Galaxy? I just don't know if the analysis would be compromised. Thanks again to you and the whole Galaxy team. Best, Mike --- On Tue, 4/12/11, Enis Afgan eaf...@emory.edu wrote: From: Enis Afgan eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: Mike Dufault dufau...@yahoo.com Cc: Anton Nekrutenko an...@bx.psu.edu, galaxy-u...@bx.psu.edu Date: Tuesday, April 12, 2011, 9:16 PM Ahh, for some reason cloudman is thinking Galaxy is not 'running' but still 'starting' and has thus not enabled the given button. To access the analysis, in your browser, just delete the '/cloud' part of the URL and that should load Galaxy. Sorry about the confusion,Enis On Tue, Apr 12, 2011 at 9:12 PM, Mike Dufault dufau...@yahoo.com wrote: Hi Enis, Thanks for looking into this. From the Galaxy Cloudman Console, I can see that it was restarted from the log (thanks), but the Access Galaxy choice is still grayed out and I don't know how to access the Analysis window. Is there a way back into my analysis? Thanks, Mike --- On Tue, 4/12/11, Enis Afgan eaf...@emory.edu wrote: From: Enis Afgan eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: Mike Dufault dufau...@yahoo.com Cc: Anton Nekrutenko an...@bx.psu.edu, galaxy-u...@bx.psu.edu Date: Tuesday, April 12, 2011, 8:55 PM Hi Mike, Try accessing your Galaxy instance now. It should be ok. The link in your email contained the IP for your instance so I took the liberty of restarting Galaxy and that brought it back up. There seems to have been an issue with Galaxy accessing its database and that resulted in Galaxy crashing. We'll look into why that happened in the first place but should be ok now. Let me know if you have any more trouble,Enis On Tue, Apr 12, 2011 at 2:49 PM, Mike Dufault dufau...@yahoo.com wrote: Hello Galaxy Staff, My data has been running on the Amazon EC2 for just over 24hrs. I have not closed any windows and my Exome analysis made it all the way through to filter on Pile up. I have two tabs for this instance. One is the Galaxy Cloudman Console and the other is the tab where I perform the analysis, load data, history etc. Anyway, I went to add a step to the work flow and the screen Welcome Galaxy to the Cloud screen along with the information There is no Galaxy instance running on this host, or the Galaxy instance is not responding. To manage Galaxy on this host, please use the Cloud Console. What happened??? When I go back to the Galaxy Cloudman Console, it shows that my instance is still running along with the four cores, the Cluster log is below. AWS also shows that my instance is running. Will the work flow finish? Can I get my data? How? I tried to re-access the analysis page by selecting Access Galaxy from the Galaxy Cloudman Console but it sends me to the same Welcome page. Is there a way to get back into the analysis page? Please help!!! Thanks, Mike The cluster log shows: 13:05:24 - Master starting13:05:25 - Completed initial cluster configuration.13:05:33 - Starting service 'SGE'13:05:48 - Configuring SGE...13:05:56 - Successfully setup SGE; configuring SGE 13:05:57 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:05:57 - Saved file 'cm_boot.py' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' 13:05:57 - Saved file 'cm.tar.gz' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:05:57 - Problem connecting to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3', attempt 1/513:05:59 - Saved file 'Fam122261.clusterName' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' 13:06:24 - Initializing a 'Galaxy' cluster.13:06:24 - Retrieved file 'snaps.yaml' from bucket 'cloudman' to 'cm_snaps.yaml'.13:06:41 - Adding 3 instance(s)... 13:07:02 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:07:38 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:07:38 - Saved file 'universe_wsgi.ini.cloud' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' 13:07:38 - Saved file 'tool_conf.xml.cloud' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:07:48 - Error mounting file system '/mnt/galaxyData' from '/dev/sdg3', running command '/bin/mount /dev/sdg3 /mnt/galaxyData' returned code '32' and following stderr: 'mount: you must specify the filesystem type '13:07:52 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:07:52 - Starting service 'Postgres'13:07:52 - PostgreSQL data directory '/mnt/galaxyData/pgsql/data' does not exist (yet?) 13:07:52 - Configuring PostgreSQL with a database for Galaxy...13:08:05 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3'13:08:05 - Starting
Re: [galaxy-user] Help!!!!!! with Galaxy Cloud!!!!!
Galaxy has the functionality to recover any jobs that were running after it's restarted so it is quite possible to for the job to still be running. In addition, from the cloudman console, it appears that at least one instance is pretty heavily loaded so that can also mean that the job is still running. However, without actually accessing the instance through the command line and checking the status of the job queue, it is not possible to tell if the job is - actually running. Do you know how to do that? It's just a few commands in the terminal: - access the instance [local]$ ssh -i path to the private key you downloaded from AWS when you created a key pair ubuntu@instance public DNS - become galaxy user [ec2]$ sudo su galaxy - list any running jobs [ec2]$ qstat If that command returns a list of jobs and the jobs are in stare 'r' (running), the job is still running; otherwise, no. Let me know how it goes, Enis On Tue, Apr 12, 2011 at 9:49 PM, Mike Dufault dufau...@yahoo.com wrote: Hi Enis, THANK YOU!!! I see that my filter pileup on data step is running. Is this the same analysis that was running before or did it relauch when you restarted Galaxy? I just don't know if the analysis would be compromised. Thanks again to you and the whole Galaxy team. Best, Mike --- On *Tue, 4/12/11, Enis Afgan eaf...@emory.edu* wrote: From: Enis Afgan eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: Mike Dufault dufau...@yahoo.com Cc: Anton Nekrutenko an...@bx.psu.edu, galaxy-u...@bx.psu.edu Date: Tuesday, April 12, 2011, 9:16 PM Ahh, for some reason cloudman is thinking Galaxy is not 'running' but still 'starting' and has thus not enabled the given button. To access the analysis, in your browser, just delete the '/cloud' part of the URL and that should load Galaxy. Sorry about the confusion, Enis On Tue, Apr 12, 2011 at 9:12 PM, Mike Dufault dufau...@yahoo.comhttp://mc/compose?to=dufau...@yahoo.com wrote: Hi Enis, Thanks for looking into this. From the Galaxy Cloudman Console, I can see that it was restarted from the log (thanks), but the Access Galaxy choice is still grayed out and I don't know how to access the Analysis window. Is there a way back into my analysis? Thanks, Mike --- On *Tue, 4/12/11, Enis Afgan eaf...@emory.eduhttp://mc/compose?to=eaf...@emory.edu * wrote: From: Enis Afgan eaf...@emory.edu http://mc/compose?to=eaf...@emory.edu Subject: Re: [galaxy-user] Help!! with Galaxy Cloud! To: Mike Dufault dufau...@yahoo.comhttp://mc/compose?to=dufau...@yahoo.com Cc: Anton Nekrutenko an...@bx.psu.eduhttp://mc/compose?to=an...@bx.psu.edu, galaxy-u...@bx.psu.edu http://mc/compose?to=galaxy-u...@bx.psu.edu Date: Tuesday, April 12, 2011, 8:55 PM Hi Mike, Try accessing your Galaxy instance now. It should be ok. The link in your email contained the IP for your instance so I took the liberty of restarting Galaxy and that brought it back up. There seems to have been an issue with Galaxy accessing its database and that resulted in Galaxy crashing. We'll look into why that happened in the first place but should be ok now. Let me know if you have any more trouble, Enis On Tue, Apr 12, 2011 at 2:49 PM, Mike Dufault dufau...@yahoo.comhttp://mc/compose?to=dufau...@yahoo.com wrote: Hello Galaxy Staff, My data has been running on the Amazon EC2 for just over 24hrs. I have not closed any windows and my Exome analysis made it all the way through to filter on Pile up. I have two tabs for this instance. One is the Galaxy Cloudman Console and the other is the tab where I perform the analysis, load data, history etc. Anyway, I went to add a step to the work flow and the screen Welcome Galaxy to the Cloud screen along with the information There is no Galaxy instance running on this host, or the Galaxy instance is not responding. To manage Galaxy on this host, please use the Cloud Consolehttp://ec2-67-202-55-176.compute-1.amazonaws.com/cloud . What happened??? When I go back to the Galaxy Cloudman Console, it shows that my instance is still running along with the four cores, the Cluster log is below. AWS also shows that my instance is running. Will the work flow finish? Can I get my data? How? I tried to re-access the analysis page by selecting Access Galaxy from the Galaxy Cloudman Console but it sends me to the same Welcome page. Is there a way to get back into the analysis page? Please help!!! Thanks, Mike The cluster log shows: - 13:05:24 - Master starting - 13:05:25 - Completed initial cluster configuration. - 13:05:33 - Starting service 'SGE' - 13:05:48 - Configuring SGE... - 13:05:56 - Successfully setup SGE; configuring SGE - 13:05:57 - Saved file 'persistent_data.yaml' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' - 13:05:57 - Saved file 'cm_boot.py' to bucket 'cm-a42f040c55e7519eb63bbaf269fa78d3' - 13:05:57 - Saved