Hello Francisc,
The Clip tool is sourced from the FASTX-tool kit, so specific edge-case
behavior should be tested out or directed at the team that developed the
tool at:
http://hannonlab.cshl.edu/fastx_toolkit/index.html
http://hannonlab.cshl.edu/fastx_toolkit/commandline.html#fastx_clipper_usage
On 1/9/12 4:33 AM, Fransisc Raul Kantor wrote:
Hi
We're a bit confused about exactly how the adaptor clipping tool works.
Is there some documentation that describes how it does the clipping? In
the clipping example given on the Galaxy page for "Clip adapter
sequences" (the adaptor is CTGTAGGCACCATCATTATTTATATAA ):
* How large a substring of the sequence must the adaptor be in order
for it to be clipped? E.g., if the sequence is ATGGACTCTG, it seems
to clip the terminal CTG, but it doesn't clip if CTG appears
somewhere in the middle of a sequence.
This is true for 3' clipping, because the adaptor leads with a CTG and
the sequence ends with a CTG. The orientation is correct and the
sequence's terminal CTG is clipped.
* Does it clip if, say, the middle part of the adaptor appears
somewhere in the middle of a sequence, and if so, how long must it
be before it clips?
Clipping off or introducing mismatches at the ends of an adaptor (up to
3 in a 10 base adaptor) still found and clipped in my test. More along
these lines should narrow down the criteria or the tool authors can clarify.
Best wishes,
Jen
Galaxy team
Thank you,
Francisc Raul Kantor
___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using "reply all" in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
--
Jennifer Jackson
http://usegalaxy.org
http://galaxyproject.org/wiki/Support
___________________________________________________________
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using "reply all" in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
