Hi Dominique,
This means that there were no results. My fault - the Filter tool is the
wrong choice. The Select tool, as you were starting with, is better for
this case. The issues you had originally were most likely with format or
the regular expression. So, be sure to do the following this time:
1. Converting to tabular format (choose 1 for the identifier on this
tool's form, to keep the output in a simple two column format)
2. Use a regular expression in the Select tool, Matching, like this:
\tATGC
Where the \t indicates tab (the tab between the two columns),
anchoring the matching text to the start of the sequence string. You
could be more specific with the regular expression if you need to,
following the guidelines on the tool help, but it probably isn't
necessary if the rest of your sequences are formatted like the examples
below.
These sequences in your example are seperated by an empty line - but I
am assuming that was just the way the data was pasted into the email. In
a properly formatted fasta file, there should be no empty lines. To
remove empty spaces in a fasta file, you can also use the Select tool
(directly on the fasta format file), with a NOT Matching and this
regular expression:
^$
Where ^ means the start of a line, and $ means the end. Together, they
indicate a blank line. NOT Matching selects all lines that are not a
blank line, e.g. have content.
Please give this a try and let us know how it works.
Jen
Galaxy team
On 12/17/12 8:53 AM, D. A. Cowart wrote:
Hi Jennifer,
Thank you for your reply.
I tried used the options you gave me to split files.
The second option, which would filter by basepair identity executes,
however, the resulting job is green but empty and says no peek in
the columns when I go to view. Do you know what this means?
Thank you,
Dominique
On Mon, Dec 17, 2012 at 7:57 AM, Jennifer Jackson j...@bx.psu.edu
mailto:j...@bx.psu.edu wrote:
Hello Dominique,
Would the tool 'NGS: QC and manipulation - Barcode Splitter' meet
your needs? Please see the tool's help for usage.
Another option is to first covert the file to tabular with 'FASTA
manipulation -FASTA-to-Tabular', then use the 'Filter and Sort -
Filter' tool. The match criteria would look something like:
c2=='ATGC' . Once done, convert back to fasta with 'FASTA
manipulation - Tabular-to-FASTA'.
Hopefully one of these methods will work out for you,
Jen
Galaxy team
On 12/14/12 11:10 AM, D. A. Cowart wrote:
Hello,
I would like to use Galaxy to divide a very large Ilumnia fasta
file (~3GB) into separate fasta files. Is this possible on
Galaxy? Here is an example of the reads:
HWI-ST156:535:C10GLACXX:8:1101:1195:1080 1:N:0:CGGTTGT
AAATAGAATATCACATTTCACAAGCAGGACAGTGTGTGTGAAATCGTGAATTCAACGTTTATCAATTAGAACGCCTACGTGTAG
HWI-ST156:535:C10GLACXX:8:1101:1210:1102 1:N:0:CGGTTGT
ATTTATCATAACAACTTAAATCAGTCAGTGGATTTCTGTCGGTCCGGTTAGCTCGGTTGGTAAAGGCGTTTGTTCGATCGTCTGTAGCAATCGGGC
I have tried the Filter and Sort option to try and select
sequences just by a beginning sequence (ATGC, for example) to
separate these sequences into a specific file, but I have been
unsuccessful in this.
Thank you,
Dominique
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
atusegalaxy.org http://usegalaxy.org. Please keep all replies on the
list by
using reply all in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
--
Jennifer Jackson
http://galaxyproject.org
--
Jennifer Jackson
http://galaxyproject.org
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org. Please keep all replies on the list by
using reply all in your mail client. For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:
http://lists.bx.psu.edu/listinfo/galaxy-dev
To manage your subscriptions to this and other Galaxy lists,
please use the interface at:
http://lists.bx.psu.edu/
