Re: [galaxy-user] bed to gff

[Jennifer Jackson]

Hello,

The first input file is not in BED format (specifically, BED12). This 
would be necessary in order to produce a GFF file with the proper 
attributes in the feature, frame, and group fields.


The tool BED-to-GFF describes these formats. BED12 files are available 
from the UCSC table browser and certain other sources. These should not 
be confused with BED6 files, which are the most common BED format in 
Galaxy.


Best wishes for your project,

Jen
Galaxy team

On 3/7/12 12:15 AM, Robin Mjelle wrote:

Dear Galaxy

I have a problem converting Interval to GFF.

I used the tool BED-to-GFF
 converter.
My Interval file contains 18 coulmns:

*chr1   3330899833309020+   cel-let-7-5p0   chr1
33308999255 22M *   0   0   AGAGGAAGAAGGAAGGAA  
UGAGGUAGUAGGUUGUAUAGUU  XA:i:0  MD:Z:22 NM:i:0*

However my GFF output only contains 9, and it has removed the feature
"*cel-let-7-5p":*

chr1bed2gff region_033308999333090200   +   
.   region_0;



Instead of region_0 I want the gene name, in this case the miRNA name.
How do I do this?

Best Robin


___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/

___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

Re: [galaxy-user] BED to GFF

[Jennifer Jackson]

Hi Keith,

Good questions - hopefully this info can help:

To get from BED3 into BED12, use the BED3 as a filter in the UCSC Table 
Browser against a gene track (UCSC Genes, RefSeq Genes, etc.) and send 
the output to Galaxy. Or better, use a BED6 so that you can include 
strand in column 6, just enter NULL values for name (".", column 4) and 
score ("0", column 5) to pad the file format out correctly so that the 
UCSC Table Browser can interpret it. Interval is a Galaxy file type, 
with the UCSC Browser, the BED format must be intact and to spec. BED 
format is defined on the BED-to-GFF tool help (scroll down).


If BED12, the features listed are interpreted from the format. If you 
want repeat information and such, then perhaps a tool like "Operate on 
Genomic Intervals -> Profile Annotations" would be a good choice. From 
the results, you could determine which ancillary tracks to pull over 
into Galaxy from the UCSC Table browser (in GTF or BED format). There 
are choices here (multiple repeat tracks, for example). Please note this 
tool is set up for human annotation currently.


When running a query in the Table browser for certain data, the way the 
internal query is structured will pull out as a result every entry in 
the track with any coverage, complete (i.e. not limited to the original 
BED/Coordinate filters). BED3 would be necessary to pull in data 
contained in introns-only, although a BED6 that included strand might be 
a better choice for some tracks (those that are stranded). Don't use a 
BED12 if you want information about the entire region (transcribed & other).


These "any coverage" results from UCSC can be trimmed down in Galaxy 
using tools in "Operate on Genomic Intervals" and "Join, Subtract and/or 
Group" (depends on the data). The process would be step-by-step the 
first time, but can be easily saved into a workflow to use again without 
having to re-do it each time around.


If you would like more help, just let us know,

Jen
Galaxy team



On 4/7/11 11:20 AM, Keith E. Giles wrote:

Hi Jen,
I actually used a BED3.  I thought the script could go to HG18 for each
entry and then see what was there.  Does the feature information need to
be in the BED file in order for it to get into the GFF file?  If so, do
you know of a way to map each aligned read to a certain feature?

On Thu, Apr 7, 2011 at 2:16 PM, Jennifer Jackson mailto:j...@bx.psu.edu>> wrote:

Hi Keith,

Are you using a full BED12 file? Or just a BED3-6? Full BED12 should
return the available features:

3. feature - The name of this type of feature. Some examples of
standard feature types are "CDS", "start_codon", "stop_codon", and
"exon".

If you would like to share a history, that would help if this is not
enough information ("Options -> Share or Publish). You can send the
link to me directly.

Best,

Jen
Galaxy team


On 4/7/11 10:46 AM, Keith Giles wrote:

I am trying to use the galaxy "BED to GFF" function.  The operation
worked, but instead of giving me back any feature information (e.g.,
exon, intron, repeat, etc.); I just received back the sequence
of the
interval contained within the BED file.  Does anyone know what
I'm doing
wrong?  Moreover, does anyone know the best way to map each read
of a
RNAseq run to a given feature?



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org .  Please keep all
replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

http://lists.bx.psu.edu/


--
Jennifer Jackson
http://usegalaxy.org
http://galaxyproject.org




--
Jennifer Jackson
http://usegalaxy.org
http://galaxyproject.org
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/

Re: [galaxy-user] BED to GFF

[Jennifer Jackson]

Hi Keith,

Are you using a full BED12 file? Or just a BED3-6? Full BED12 should 
return the available features:


3. feature - The name of this type of feature. Some examples of standard 
feature types are "CDS", "start_codon", "stop_codon", and "exon".


If you would like to share a history, that would help if this is not 
enough information ("Options -> Share or Publish). You can send the link 
to me directly.


Best,

Jen
Galaxy team

On 4/7/11 10:46 AM, Keith Giles wrote:

I am trying to use the galaxy "BED to GFF" function.  The operation
worked, but instead of giving me back any feature information (e.g.,
exon, intron, repeat, etc.); I just received back the sequence of the
interval contained within the BED file.  Does anyone know what I'm doing
wrong?  Moreover, does anyone know the best way to map each read of a
RNAseq run to a given feature?



___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

   http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

   http://lists.bx.psu.edu/


--
Jennifer Jackson
http://usegalaxy.org
http://galaxyproject.org
___
The Galaxy User list should be used for the discussion of
Galaxy analysis and other features on the public server
at usegalaxy.org.  Please keep all replies on the list by
using "reply all" in your mail client.  For discussion of
local Galaxy instances and the Galaxy source code, please
use the Galaxy Development list:

 http://lists.bx.psu.edu/listinfo/galaxy-dev

To manage your subscriptions to this and other Galaxy lists,
please use the interface at:

 http://lists.bx.psu.edu/