If you don't specify the :out adverb, then the output of the program you
are running will be sent to standard output. Immediately when the program
executes. If you specify the :out adverb, output from the program will be
available for capture via the $proc.out method. A similar thing applies
On Tue, May 1, 2018 at 8:37 AM, ToddAndMargo wrote:
> Hi All,
>
> I am trying to change the last three letters of a string
>
> $ perl6 -e 'my $x="abcabcabc"; $x ~~ s/"a.*"$/xyz/; say $x;'
>
The double quotes around your text make it a string literal, so it will
only match
Looking at that page myself, it doesn't appear that you can specify the
separator for .words. So ... no.
Though, that would make an interesting addition IMHO
-Scott
On Sat, Apr 14, 2018 at 12:27 AM, ToddAndMargo
wrote:
> Hi All,
>
> I am over on
>
If, by "regular book", you mean "bound paper sheafs with ink on them", then
the answer is currently "no". Is there something wrong with the
documentation online? (besides there not being enough of it :)
-Scott
On Mon, Jan 4, 2016 at 9:55 PM, Yonghua Peng wrote:
> Hello,
The block does get the topic, but the regex isn't executing immediately.
Another way to get what you want, rather than mentioning the topic
explicitly, is to use the m// form of match.
> grep { m/\.pl6/ },
(a.pl6)
For sanity's sake, I would recommend writing your match-immediately regex
like
I imagine it's the same problem as this Perl 5 code:
use Test::More;
for ('GATGGAACTTGACTACGTAAATT') {
s/T/U/g;
is $_, 'GAUGGAACUUGACUACGUAAAUU', 'RNA';
}
Since $_ is an alias for each element of the list and the only element in
the list is a constant string and you can't modify
On Thu, Apr 21, 2011 at 6:33 PM, gvim gvi...@gmail.com wrote:
This is not a criticism of anything. I am not a core developer but need to
be aware of what to expect when Perl 6 settles down into a production-ready
state. The Perl 6 binary within the January release of Rakudo Star is 10Mb
on my
are scheduled to occur two days after each
Parrot monthly release. Parrot releases the third Tuesday of each month.
Have fun!
-Scott
--
Jonathan Scott Duff
perlpi...@gmail.com
::Caller which fails to work using that compiler combination (i.e.,
fails all tests after a build using its makefile and Visual Studio 2003 as
the C compiler).
Bummer. You could check out the Vanilla/Strawberry Perl effort at
http://win32.perl.org/
-Scott
--
Jonathan Scott Duff
[EMAIL PROTECTED]
. Not that perl shouldn't let the
programmer get himself in trouble, but this seems like one of those
things that should require asking to turn on rather than asking to
turn off.
my two cents,
-Scott
--
Jonathan Scott Duff
[EMAIL PROTECTED]
10 matches
Mail list logo