Re: Mutil Method Questions

. Not that perl shouldn't let the programmer get himself in trouble, but this seems like one of those things that should require asking to turn on rather than asking to turn off. my two cents, -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Re: [ANNOUNCE] Pugs 6.2.12 and v6.pm released! (reformatted)

::Caller which fails to work using that compiler combination (i.e., fails all tests after a build using its makefile and Visual Studio 2003 as the C compiler). Bummer. You could check out the Vanilla/Strawberry Perl effort at http://win32.perl.org/ -Scott -- Jonathan Scott Duff [EMAIL PROTECTED]

Rakudo Perl 6 development release #22 (Thousand Oaks)

are scheduled to occur two days after each Parrot monthly release. Parrot releases the third Tuesday of each month. Have fun! -Scott -- Jonathan Scott Duff perlpi...@gmail.com

Re: Current vs future Perl 6 binary size

On Thu, Apr 21, 2011 at 6:33 PM, gvim gvi...@gmail.com wrote: This is not a criticism of anything. I am not a core developer but need to be aware of what to expect when Perl 6 settles down into a production-ready state. The Perl 6 binary within the January release of Rakudo Star is 10Mb on my

Re: s:g/T/U/ doesn't work ?

I imagine it's the same problem as this Perl 5 code: use Test::More; for ('GATGGAACTTGACTACGTAAATT') { s/T/U/g; is $_, 'GAUGGAACUUGACUACGUAAAUU', 'RNA'; } Since $_ is an alias for each element of the list and the only element in the list is a constant string and you can't modify

Re: grep changes?

The block does get the topic, but the regex isn't executing immediately. Another way to get what you want, rather than mentioning the topic explicitly, is to use the m// form of match. > grep { m/\.pl6/ }, (a.pl6) For sanity's sake, I would recommend writing your match-immediately regex like

Re: learning perl6?

If, by "regular book", you mean "bound paper sheafs with ink on them", then the answer is currently "no". Is there something wrong with the documentation online? (besides there not being enough of it :) -Scott On Mon, Jan 4, 2016 at 9:55 PM, Yonghua Peng wrote: > Hello,

Re: need s/ help

On Tue, May 1, 2018 at 8:37 AM, ToddAndMargo wrote: > Hi All, > > I am trying to change the last three letters of a string > > $ perl6 -e 'my $x="abcabcabc"; $x ~~ s/"a.*"$/xyz/; say $x;' > The double quotes around your text make it a string literal, so it will only match

Re: using run

If you don't specify the :out adverb, then the output of the program you are running will be sent to standard output. Immediately when the program executes. If you specify the :out adverb, output from the program will be available for capture via the $proc.out method. A similar thing applies

Re: Does words have a delimiter?

Looking at that page myself, it doesn't appear that you can specify the separator for .words. So ... no. Though, that would make an interesting addition IMHO -Scott On Sat, Apr 14, 2018 at 12:27 AM, ToddAndMargo wrote: > Hi All, > > I am over on >