On 2007-06-25, [EMAIL PROTECTED] [EMAIL PROTECTED] wrote:
On Jun 25, 1:43 am, Martin v. Löwis [EMAIL PROTECTED] wrote:
[EMAIL PROTECTED] schrieb:
This wiki page suggests using a chroot jail to sandbox Python, but
wouldn't running something like this in your sandboxed Python instance
still
On 2007-04-11, [EMAIL PROTECTED] [EMAIL PROTECTED] wrote:
On Apr 11, 9:14 am, Marc 'BlackJack' Rintsch [EMAIL PROTECTED] wrote:
In [EMAIL PROTECTED], shamzz wrote:
Shouldn't zlib be compiled as a Python module automatically in Python
2.4.4. I'm guessing Python is doing some kind of check
On 2007-03-22, Jaroslaw Zabiello [EMAIL PROTECTED] wrote:
I try to connect to web services (written in C#/.NET) with latest ZSI
2.0rc3 library. It just does not work.
from ZSI.ServiceProxy import ServiceProxy
wsdl = 'http://192.168.0.103/NewWebServices/TemplateInsert.asmx?wsdl'
print
On 2006-12-02, Robert Kern [EMAIL PROTECTED] wrote:
Beliavsky wrote:
When I print an array in any language, I (and I think most programmers)
expect by default to have all elements displayed. Matlab, R, and
Fortran 95 have somewhat similar arrays to numpy, and that is what they
do. I don't
In article [EMAIL PROTECTED], nuttydevil wrote:
I have many notepad documents that all contain long chunks of genetic
code. They look something like this:
atggctaaactgaccaagcgcatgcgtgttatccgcgagaaagttgatgcaaccaaacag
tacgacatcaacgaagctatcgcactgctgaaagagctggcgactgctaaattcgtagaa
In article [EMAIL PROTECTED], Sandro Dentella wrote:
Il 2006-01-09, John Bauman [EMAIL PROTECTED] ha scritto:
Sandro Dentella [EMAIL PROTECTED] wrote in message
news:[EMAIL PROTECTED]
I need a (decent) canvas for PyGTK. I used tkinter.canvas with real
pleasure
in the past but now I need to
In article [EMAIL PROTECTED], Greg Stein wrote:
Guido would acknowledge a query, but never announce it. That's not his
style.
This should have a positive impact on Python. His job description has a
*very* significant portion of his time dedicated specifically to
working on Python. (much
In article [EMAIL PROTECTED], tooper wrote:
Hello,
Did anybody tried python pickle module over heterogeneous 32/64 bits
mpi exchanges to overcome the translation problem ? i.e. pickling on
one side (let's say a 32-bits OS side), sending the buffer as string
through mpi and unpickling on the
In article [EMAIL PROTECTED], [EMAIL PROTECTED] wrote:
Hi,
has anybody thought of / already used graphviz to convert the output of
trace.py into a graph? I looked at PyUMLGraph, but 1. PyUMLGraph does
not successfully create a dot file, and 2. I don't really want a UML
representation but a
In article [EMAIL PROTECTED], Ben Finney wrote:
Brian Victor [EMAIL PROTECTED] wrote:
[EMAIL PROTECTED] wrote:
Torsten Bronger wrote:
I've been having a closer look at wxPython which is not Pythonic at
all and bad documented. Probably I'll use it nevertheless.
Aye. Couldn't agree more.
On 2005-08-10, Bryan Olson [EMAIL PROTECTED] wrote:
The easiest approach, though, is to use the threadedselectreactor in
Twisted (you need
to check the HEAD branch out with subversion, because that reactor
isn't included in any releases).
With threadedselectreactor, it's easy to
On 2005-08-10, Peter Hansen [EMAIL PROTECTED] wrote:
David E. Konerding DSD staff wrote:
Further, calling wx from a thread other than the one running the event
loop is deep voodoo and should typically be avoided.
Typically? Let's just say always and maybe use the phrase certain
In article [EMAIL PROTECTED], perchef wrote:
Hi,
I have several files to download and a GUI to update. I know this is a
frequently asked question but i can't find an appropriate solution.
My Downloader extends threading.Thread and update a wx.Gauge in GUI
during the process.
for src in
In article [EMAIL PROTECTED], Randall Hopper wrote:
Thomas Heller:
| Python - C++ - Python Callback
|
| (example attached) an exception raised in the callback doesn't make it back
| across C++ to Python.
...
| void callback_wrapper( void *user_data )
| {
| // Acquire interpreter
On 2005-02-26, Just [EMAIL PROTECTED] wrote:
While googling for a non-linear equation solver, I found
Math::Polynomial::Solve in CPAN. It seems a great little module, except
it's not Python... I'm especially looking for its poly_root()
functionality (which solves arbitrary polynomials).
In article [EMAIL PROTECTED], Chris Lasher wrote:
Hello,
I have a rather large (100+ MB) FASTA file from which I need to
access records in a random order. The FASTA format is a standard format
for storing molecular biological sequences. Each record contains a
header line for describing the
16 matches
Mail list logo
