[R] ANOVA in R

ID a_t1a_t2b_t1b_t2 CACCCGTAGAACCGACCTTGCG_mmu-miR-99b-5p15781941234810941 CACCCGTAGAACCGACCTTGC_mmu-miR-99b-5p4424265643839 CACCCGTAGAACCGACCTTG_mmu-miR-99b-5p544366253 CCGTAGAACCGACCTTGCG_mmu-miR-99b-5p263333157

[R] correlation between rows of different data frames

Hi, I have two data frames with time serie datamatrix. I want to pick a row X from the first matrix and see if it correlates with row Y in the second matrix. These are gene expression values and I probaly need to do some scaling first, but I wonder if you have any suggestions on how to do the

[R] EdgeR annotation

after updating R and edgeR I lost the annotations in the final Diff.Expressed matrix (toptags) when running the edgeR pipeline. How do I get the row.names from the data matrix into the topTag-matrix? data - read.table(KO_and_WT_Summary_miRNA_Expression.csv, row.names=1, sep=, header=T) keep -

[R] strings

I have two files containing words. I want to print the are in file 1 but NOT in file 2. How do I go about? file 1: ABL1 1 ALKBH1 2 ALKBH2 3 ALKBH3 4ANKRD17 5 APEX1 6 APEX2 7 APTX 8 ASF1A 9 ASTE1 10 ATM 11 ATR 12 ATRIP 13 ATRX 14

[R] Overlay two stat_ecdf() plots

I want to plot two scdf-plots in the same graph. I have two input tables with one column each: Targets - read.table(/media/, sep=, header=T) NonTargets - read.table(/media/..., sep=, header=T) head(Targets) V1 1 3.160514 2 6.701948 3 4.093844 4 1.992014 5 1.604751 6 2.076802

[R] facet plot

Hi all, I want to plot a facet plot with column names as x and column values as y. One plot for each row. here is part of my dataset: Gene T0h T0.25h T0.5h T1h T2h T3h T6h T12h T24h T48h NM_001001130 68 95 56 43 66 62 68 90 63 89 NM_001001144 0 1 4 0 1 1 1 4 1 2 NM_001001152 79 129 52 50