[R] CIE Diagram with wavelengths tick marks

with the cieplot() function # attr(coldat2, "clrsp") <- "CIEXYZ" # colnames(coldat2) <- c("x", "y", "z") # cieplot(coldat2, col="white", main="CIE Test Plot") # Best regards # Tilmann ___ Ken

Re: [R] lines through points in lattice legend

Thanks.  That works well and it's simple. Ken ___ Kenneth Knoblauch Inserm U1208 Stem-cell and Brain Research Institute 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91 34 61 portable: +33 (0)6 84 10 64 10 https://sbri.fr/public-profile

[R] lines through points in lattice legend

[1] lattice_0.20-45 loaded via a namespace (and not attached): [1] compiler_4.2.2 grid_4.2.2 Thanks for any enlightenment, in advance. Ken ___ Kenneth Knoblauch Inserm U1208 Stem-cell and Brain Research Institute 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 7

[R] Need Help To Solve An Equation In R

and there would be an unknown h that I need to find. I need to equate this lhs to p_star value in order to find h. Which function should I use to solve this equation? Please guide me regarding this. Thank you. -- With Regards, Neetu Shah, B.Tech.(CS), 3rd Year, IIIT Vadodara. -- Kenneth Knoblauch I

Re: [R] meaning of lm( y~., data=mydat ), is it a language feature, is it documented, is it supported?

s and Informatics > University of Maryland School of Medicine Division of Gerontology and Geriatric Medicine > Baltimore VA Medical Center > 10 North Greene Street > GRECC (BT/18/GR) > Baltimore, MD 21201-1524 > (Phone) 410-605-7119 > (Fax) 410-605-7913 > How about section

Re: [R] Opposite color in R

see ww.cvrl.org under New CIE XYZ functions transformed from the CIE (2006) LMS functions best, Ken -- Kenneth Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4

Re: [R] Help with GLM starting values in user defined link function

warnings() to see them) HTH Andrew Hoskins Postdoctoral reasearch fellow Ecosystem Sciences CSIRO E Andrew.Hoskins at csiro.au T +61 2 6246 5902 Black Mountain Laboratories Clunies Ross Street, Acton, ACT 2601, Australia www.csiro.au -- Kenneth Knoblauch Inserm U846 Stem-cell

Re: [R] outer() problem

, respectively in your case; Thanks a lot Marc -- Kenneth Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91 34 61 portable: +33 (0)6 84 10 64 10 http

Re: [R] Generate Binary Matrix

Doran, Harold HDoran at air.org writes: I am trying to generate a binary matrix where row in the matrix is guaranteed to have at least one 1. Ideally, I would like most rowSums to be equal 2 or 3 with some 1s and some 4s. But, rowSums cannot be equal to 0. I can tinker with the

Re: [R] How do I perform conditional annotation of lattice panel plots?

) wh - Data[subscripts, ] panel.abline(v = wh$Day[!is.na(wh$EventA)]) }) -- Kenneth Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33

Re: [R] Adding the complementary log-link to binomial() and make.link()

and they all still work under the current version of R. Thanks a lot, Roland Deutsch -- Kenneth Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91 34 61 portable

Re: [R] Select fixed number of elements

- seq(rx[1], rx[2], len = 6) sapply(br, function(bx){ x[which.min(abs(x - bx))] }) [1] 0.02910779 0.22708582 0.39239718 0.52419265 0.68940262 0.86889817 Regards Alex -- Kenneth Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences

Re: [R] speeding up sum of squared differences calculation

, please notify the sender immediately via +44(0)20 8943 7000 or notify postmas...@lgcgroup.com and delete this message and any copies from your computer and network. LGC Limited. Registered in England 2991879. Registered office: Queens Road, Teddington, Middlesex, TW11 0LY, UK -- Kenneth Knoblauch

Re: [R] colour code areas of a plot

light and dark regions to highlight condition changes. See ?rect, of course. thanks for any suggestions! -- Kenneth Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax

Re: [R] speeding up

(X)) { ans - ans + (X[i]-X[j])*(X[i]-X[j]) } }) user system elapsed 2.241 0.009 2.293 system.time(2 * sum(c(dist(X))^2)) user system elapsed 0.038 0.002 0.040 and then there is Rcpp if you want to add some extra grease. -- Kenneth Knoblauch Inserm U846 Stem-cell

Re: [R] speeding up

Ken Knoblauch ken.knoblauch at inserm.fr writes: Bos, Roger roger.bos at rothschild.com writes: I am using a sum of squared differences in the objective function of an optimization problem I am doing and I have managed to speed it up using the outer function versus the nested

Re: [R] import function without overwriting function with the same name

haven't done this before but env.lst - lapply(1:5, new.env) seems to work just fine env.lst [[1]] environment: 0x108928b20 [[2]] environment: 0x1089295f8 [[3]] environment: 0x10892a908 [[4]] environment: 0x10892a438 [[5]] environment: 0x10892aea0 Thanks! -- Kenneth Knoblauch Inserm

Re: [R] grDevices::convertColor XYZ space is it really xyY?

/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Kenneth Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91 34 61

Re: [R] grDevices::convertColor XYZ space is it really xyY?

developing. Bryan On Jun 12, 2013, at 4:36 PM, Ken Knoblauch ken.knobla...@inserm.fr wrote: You seem to treating the input values as xyY when they should be XYZ (case matters). So, I would do something like this D65 - c(0.3127, 0.329, 0.3583) X - 100 * D65[1] Y - 100 * D65[2] Z - 100 * D65[3] XYZ

Re: [R] measuring distances between colours?

Hi John, Out of curiosity and if it is not much trouble, I would be curious if Luv worked any better than Lab. I think that Luv is supposed to be preferred for monitors and Lab for surfaces but they are generally pretty similar. Best, Ken Sent from my iPhone ___ Ken Knoblauch Inserm U846

Re: [R] measuring distances between colours?

I'd have to look it up and I'm not home at the moment. Can see later on. I would have thought that it would be normalized to have a jnd equal to 1 but I'm not sure. Ken Sent from my iPhone ___ Ken Knoblauch Inserm U846 Stem-Cell and Brain Research Institute 18 av du Doyen Lépine 69500 Bron

Re: [R] measuring distances between colours?

Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91 34 61 portable: +33 (0)6 84 10 64 10 http://www.sbri.fr/members/kenneth-knoblauch.html

Re: [R] plotting CIE chromaticity diagram?

no information on color appearance, per se. They specify what lights look alike, not what they look like. -- Kenneth Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33

Re: [R] plotting CIE chromaticity diagram?

. /sermon -- Kenneth Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91 34 61 portable: +33 (0)6 84 10 64 10 http://www.sbri.fr/members/kenneth-knoblauch.html

Re: [R] plotting CIE chromaticity diagram?

Knoblauch ken.knobla...@inserm.fr wrote: ishi soichi soichi777 at gmail.com writes: Has anyone plotted or is it possible to plot CIE *xy* chromaticity diagram http://en.wikipedia.org/wiki/File:CIE1931xy_blank.svg I need this plot in color. ishida sermon And following up on my previous mail

Re: [R] how to suppress the intercept in an lm()-like formula method?

, starting where the variable xint is defined. best, Ken -- Kenneth Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91 34 61 portable: +33 (0)6 84 10 64 10 http

Re: [R] [lattice] how to label panels with variable value (not name)?

(an atmospheric pressure), rather than the name or index of the level. How to do that? TIA, Tom Roche Tom_Roche at pobox.com maybe, see ?strip.custom in lattice -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500

Re: [R] [lattice] how to label panels with variable value (not name)?

On Sun, Nov 18, 2012 at 8:09 AM, Ken Knoblauch ken.knobla...@inserm.fr wrote: Tom Roche Tom_Roche at pobox.com writes: As described @ clipped However I will need to before-and-after compare this to the results of a reboxing, or 3D regridding, of this data, so I would prefer

Re: [R] history and readline, Mac OSX

://R.research.att.com/libs/ TIA -- Christian -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91 34 61 portable: +33 (0)6 84 10 64 10 http://www.sbri.fr

Re: [R] blank plot----how do I make symbols appear

Jessica da Silva jessica.m.dasilva at gmail.com writes: I am trying to create a scatterplot, coding each point to one of 5 populations. I was successful when I did this for one set of data, yet when I try plotting other data a blank plot appears (although the axes are labelled and I can

Re: [R] self-starter functions for y = a + b * c^x

for this. It was designed to fit gamma functions to the luminance vs frame buffer values measured on CRT screens. But the functional form is similar. thx Christof best, Ken -- Kenneth Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen

[R] [R-pkgs] new package MPDiR version 0.1-11

We announce the release of package MPDiR version 0.1-11 which contains data sets and functions to support the forthcoming book Modeling Psychophysical Data in R by K. Knoblauch and L. T. Maloney, Use R! Vol 32, Springer (expected publication date: September 2012). The package includes several

Re: [R] Seeking help with LOGIT model

Christofer Bogaso bogaso.christofer at gmail.com writes: Dear all, I am fitting a LOGIT model on this Data... snip --- glm(Data[,1] ~ Data[,-1], binomial(link = logit)) Call: glm(formula = Data[, 1] ~ Data[, -1], family = binomial(link = logit)) Coefficients: (Intercept)

Re: [R] Seeking help with LOGIT model

!) However could not understand what you mean by You seem to be getting complete separation on X5 ? Can you please be more elaborate? Thanks, On Thu, Apr 12, 2012 at 4:06 PM, ken knoblauch ken.knobla...@inserm.fr wrote: Christofer Bogaso bogaso.christofer at gmail.com writes: Dear all, I am fitting

Re: [R] Apply function to every 'nth' element of a vector

) mysquare - function (x) { return (x*x) } w - applyfun(v, mysquare, 2) then w should be c(1, 4, 3, 16) Michael Bach Hi Michael, v^(2 - seq_along(v) %% 2) [1] 1 4 3 16 Ken -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du

Re: [R] Apply function to every 'nth' element of a vector

ken knoblauch ken.knoblauch at inserm.fr writes: Michael Bach phaebz at gmail.com writes: how do I e.g. square each second element of a vector with an even number of elements? Or more generally to apply a function to every 'nth' element of a vector. I looked into the apply

Re: [R] User defined link function with extra parameters

this parameter in the estimation or do I have to write my own estimator with optim()? If the parameter cannot be made into a coefficient of the linear predictor, then I'm afraid that you will have to roll your own. Thanks, BP -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute

Re: [R] How to get intersection of multiple vectors?

(a,b,c,d), v2 = c(a,b,e), v3 = c(a,f,g))) Many thanks -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91 34 61 portable

Re: [R] clear plot linear mixed model

Christof Kluß ckluss at email.uni-kiel.de writes: Am 02-01-2012 10:54, schrieb ken knoblauch: Christof Klußcklussat email.uni-kiel.de writes: lme- lme(conc ~ name/time - 1, random=conc~time|nr,method=ML,data=measurements) see plot.augPred in the nlme package thx, but how to set primary

Re: [R] clear plot linear mixed model

for the measurements (nr). How would you do that? thx Christof see plot.augPred in the nlme package -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91

Re: [R] palettes for the color-blind

://statmath.wu.ac.at/~zeileis/papers/ Zeileis+Hornik+Murrell-2009.pdf HTH, Ken -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91 34 61 portable: +33 (0)6 84 10 64 10

Re: [R] Plotting a polygon with xyplot

- with(Data_poly, which(z 240)) D_poly - rbind(Data_poly[fh, ], Data_poly[-rev(fh), ]) D_poly - rbind(D_poly, Data_poly[1, ]) plot(z ~ y, D_poly, type = n) with(D_poly, polygon(y, z, col = lightblue)) -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences

Re: [R] reading a matlab file

. -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91 34 61 portable: +33 (0)6 84 10 64 10 http://www.sbri.fr/members/kenneth-knoblauch.html

Re: [R] how to incorporate prior base probabilities into binomial glmm

and others of 3. Perhaps, the following would work then glmer(y ~ EffortLevel/(effort + costs + scr) + (1 | id), family = binomial) I think that if each observer has a unique id, that the nesting will be automatic for this variable, but you should verify that. -- Ken Knoblauch Inserm U846 Stem-cell

Re: [R] sensitivity logical operators in R

) [1] TRUE and see the R FAQ 7.31 -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91 34 61 portable: +33 (0)6 84 10 64 10 http://www.sbri.fr/members

Re: [R] Deselect one of the array's matrix

like to thank you in advance for your help Best Regards Alex [[alternative HTML version deleted]] Read section 2.7 of An Introduction to R that comes with the distribution. -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative

Re: [R] Still confused with lapply

],df1[i,3])) why bother with lapply when you can just do this with(df1, cbind(df1[[1]] * df1[[2]], df1[[2]] + df1[[3]])) HTH Ken -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4

Re: [R] Several Lattice plots in one Plot

, layout = c(2, 6)) for which you can add additional annotations as desired. By the way, do you realize that you have repeated column names in your data frame? HTH, Ken -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du

Re: [R] R package to identify model

Peng, C cpeng.usm at gmail.com writes: what is ESP package? Thanks. I've heard that It's only available over from a repository accessible through a next-generation wifi system call oui-ja. (Beware humor travels poorly over the internet and across linguistic differences!).

Re: [R] Stack with factors

] FALSE so I think that this at least explains why it doesn't work as you expected. Thank you for your help. Kenneth -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34

Re: [R] Direction and scaling of cumulative distribution in ecdfplot

= function(x, y = NULL, ...){ panel.ecdflt(x, ...) }) Many thanks, Jeff -- Jeff Stevens Research Scientist Center for Adaptive Behavior and Cognition Max Planck Institute for Human Development Lentzealle 94 14195 Berlin, Germany -- Ken Knoblauch Inserm U846 Stem-cell

Re: [R] lty dots pdf issue

Roger Koenker rkoenker at uiuc.edu writes: I'm trying to redo an old plot with: sessionInfo() R version 2.11.0 Under development (unstable) (2010-02-09 r51113) x86_64-apple-darwin9.8.0 When I do: pdf(lty.pdf,height = 6, width = 8) u - 1:100/100 y - matrix(rep(1:10,each = 100),100)

Re: [R] NextMethod() example from S Programming by Vena bles and Ripley (page 78)

] 1 attr(,class) [1] c1 c2 -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91 34 61 portable: +33 (0)6 84 10 64 10 http://www.sbri.fr/members/kenneth

Re: [R] Sweave, lty = 3 line incorect in pdf output

Knoblauch wrote: I'm having a problem with dotted lines (lty = 3) in the pdf output in documents generated with Sweave. In the displayed pdf, the dotted line does not show up and in the printed output, it is there but does not seem to respect the lwd argument, for example, it is very faint despite

Re: [R] Sweave, lty = 3 line incorect in pdf output

Knoblauch wrote: I'm having a problem with dotted lines (lty = 3) in the pdf output in documents generated with Sweave. In the displayed pdf, the dotted line does not show up and in the printed output, it is there but does not seem to respect the lwd argument, for example, it is very faint despite

Re: [R] Fast way to determine number of lines in a file

Hadley Wickham hadley at rice.edu writes: Hi all, Is there a fast way to determine the number of lines in a file? I'm looking for something like count.lines analogous to count.fields. Hadley How about something like length(readLines(fname)) Ken

Re: [R] color blending and transparency

used. Best, baptiste Ken -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91 34 61 portable: +33 (0)6 84 10 64 10 http://www.sbri.fr/members

[R] term.formula error when updating an nls object

-darwin9.8.0 locale: [1] en_US.UTF-8/en_US.UTF-8/C/C/en_US.UTF-8/en_US.UTF-8 attached base packages: [1] stats graphics grDevices utils datasets methods [7] base Thanks, in advance, for any help. Ken -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department

Re: [R] term.formula error when updating an nls object

/(Contrast^fx + sig^fx)), start = list(Rm = 30, sig = 0.05, ex = 3, fx = 3.1)) -Peter Ehlers Ken Knoblauch wrote: Hi, I'm getting an error that I don't understand when updating an nls object. Here is a toy example. dd - structure(list(Contrast = c(0.00376, 0.03759

Re: [R] Problem with expand.grid

933 -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91 34 61 portable: +33 (0)6 84 10 64 10 http://www.sbri.fr/members/kenneth-knoblauch.html

Re: [R] Getting Rd pages right for redefined S3 generic

other data frame methods. My rbind.mlds.df works fine with them, and I document it accordingly. HTH. Ken -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0

Re: [R] How do I run to or more R consoles on Mac OS X?

to open as many copies of the app as you like. Be careful though, because these inherit environment variables from the terminal session, not necessarily the same as those when running the app from the Finder. I was bitten by that the first time I tried this. Ken -- Ken Knoblauch Inserm U846 Stem

Re: [R] design matrix construction question

- 1, dd) za:xf zb:xf 1 1 0 2 1 0 3 1 0 4 0 0 5 0 0 6 0 0 7 0 1 8 0 1 attr(,assign) [1] 1 1 attr(,contrasts) attr(,contrasts)$z [1] contr.treatment thanks Ben Bolker -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research

Re: [R] dichromat, regexp, and grid objects

% of the population would have trouble discriminating. Ken -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91 34 61 portable: +33 (0)6 84 10 64 10 http://www.sbri.fr

Re: [R] How to convert numbers to words?

that does this? Thanks, Derek McCrae Norton Try Rnews Volume 5/1, May 2005, The Programmer's Niche by John Fox How Do You Spell That Number? -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France

[R] [R-pkgs] new package MLCM: Maximum Likelihood Conjoint Measurement

desirability. This package contains tools to estimate the additive contribution of the n scales to the judgment by a maximum likelihood method under several hypotheses of how the perceptual dimensions interact. -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative

Re: [R] Compare lm() to glm(family=poisson)

link function with the poisson family is log. So, these are things to take into account in any potential comparison. Ken -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34

Re: [R] overshoot of formula line in summary output of Sweave

Ben Bolker bolker at ufl.edu writes: Here is a toy example that illustrates the overshoot of the formula \documentclass[12pt]{article} \usepackage{geometry} \geometry{left=2in,right=2in} \begin{document} keep.source=TRUE= op - options(width = 65, digits = 3) ddataframe -

Re: [R] overshoot of formula line in summary output of Sweave

Ben Bolker bolker at ufl.edu writes: In the Sweave output for summary for several types of model objects and also for the comparison of models with anova, I find that that the display of the call(s) or formula does not obey the width option, even with keep.source=TRUE set, so that a long

[R] overshoot of formula line in summary output of Sweave

-- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91 34 61 portable: +33 (0)6 84 10 64 10 http://www.sbri.fr/members/kenneth-knoblauch.html

Re: [R] Splicing factors without losing levels

) xy } splice.factor(factor(1:3), factor(4:6)) [1] 1 4 2 5 3 6 Levels: 1 2 3 4 5 6 -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91

Re: [R] reliability, scale scores in the psych package

Doran, Harold HDoran at air.org writes: Ista There are several functions in the MiscPsycho package that can be sued for classical item analysis. Since when is classical item analysis a crime? No wonder the USA is considered such a litigious society! Ken -- Ken Knoblauch Inserm U846

Re: [R] difference between assignment syntax - vs =

ergonomy! -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91 34 61 portable: +33 (0)6 84 10 64 10 http://www.sbri.fr/members/kenneth-knoblauch.html

Re: [R] difference between assignment syntax - vs =

It's easier to read. Better machine-human interaction. ergonomic: (esp. of workplace design) intended to provide optimum comfort and to avoid stress or injury. Quoting Wacek Kusnierczyk waclaw.marcin.kusnierc...@idi.ntnu.no: Ken Knoblauch wrote: Wacek Kusnierczyk

[R] length 1 offset in glm

Thanks for any enlightenment. Ken -- Ken Knoblauch Inserm U846 Stem-cell and Brain Research Institute Department of Integrative Neurosciences 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91 34 61 portable: +33 (0)6 84 10 64 10 http://www.sbri.fr/members

Re: [R] parsing problem

something more elegant, but you need something like, as.numeric(sapply(with(dd, strsplit(levels(Placebo)[Placebo], m)), [[, 1)) -- Ken Knoblauch Inserm U846 Institut Cellule Souche et Cerveau Département Neurosciences Intégratives 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77

Re: [R] parsing problem

Ken Knoblauch ken.knoblauch at inserm.fr writes: venkata kirankumar kiran4u2all at gmail.com writes: I am trying to parse a vector for caliculating minimum in that vector the vector having values like 1Kontrolle 2 Placebo 3 125mg/kg 4 250mg/kg

Re: [R] R for Computational Neuroscience?

psychophysical data which are relevant for behavioral neuroscience, psyphy, MLDS, sdtalt, etc. Would there be enough for CRAN TASK VIEW? Ken -- Ken Knoblauch Inserm U846 Institut Cellule Souche et Cerveau Département Neurosciences Intégratives 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72

Re: [R] glm binomial loglog (NOT cloglog) link

of the make.link function can be useful to. Ken -- Ken Knoblauch Inserm U846 Institut Cellule Souche et Cerveau Département Neurosciences Intégratives 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91 34 61 portable: +33 (0)6 84 10 64 10 http://www.sbri.fr

Re: [R] Predictions with GAM

) in your case. I added the appropriate columns into my data frame and also to the newdata for predict. You can see an example in the appendix of http://www.journalofvision.org/8/16/10/ HTH, Ken -- Ken Knoblauch Inserm U846 Institut Cellule Souche et Cerveau Département Neurosciences

Re: [R] boxplot via plot command

(label3,150)) df - data.frame(as.factor(l), x) plot(df) Just to complete my response, the documentation for plot.data.frame indicates For a two-column data frame it plots the second column against the first by the most appropriate method for the first column. kk -- Ken Knoblauch Inserm U846

Re: [R] boxplot via plot command

Hi, Antje niederlein-rstat at yahoo.de writes: Hi folks, I've just discovered that the following code leads to boxplot (surprisingly to me). Can anybody explain to me why? Is this documented somewhere? I've never consider this option before. x - rnorm(300) l - c(rep(label1,100),

Re: [R] Fitting a modified logistic with glm?

(psyphy) fit - glm(y ~ x, binomial(mafc.logit(2)), control = glm.control(maxit = 100)) # default didn't converge x.ord - order(x) lines(x[x.ord], fitted(fit)[x.ord], col = red, lwd = 3) HTH, Ken -- Ken Knoblauch Inserm U846 Institut Cellule Souche et Cerveau Département Neurosciences

Re: [R] Fw: It 's correct to do contrasts for a GLM?

, it is not incorrect to use them in GLM? there is a way to do contrasts between treatments for GLM as a Tukey for the ANOVA? Susana see https://stat.ethz.ch/pipermail/r-help/2003-November/041559.html -- Ken Knoblauch Inserm U846 Institut Cellule Souche et Cerveau Département Neurosciences Intégratives 18

Re: [R] Fw: It 's correct to do contrasts for a GLM?

Ken Knoblauch ken.knoblauch at inserm.fr writes: Susana Zuloaga szuloaga_aguilar at hotmail.com writes: Hi all I am one recent user of R and have a few doubts I did a binomial GLM with 3 - factor and now I have to test contrasts to identify that treatments are different. I

[R] puzzle about contrasts

Knoblauch Inserm U846 Institut Cellule Souche et Cerveau Département Neurosciences Intégratives 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91 34 61 portable: +33 (0)6 84 10 64 10 http://www.sbri.fr __ R-help@r

Re: [R] using complete.cases() with nested factors

Andrew Barr wabarr at gmail.com writes: This maybe a newbie question. I have a dataframe that looks like the sample at the bottom of the email. I have monthly precipitation data from several sites over several years. For each site, I need to extract years that have a complete series of

Re: [R] Multiple R console for OS X?

Anh Tran anhnttran at ucla.edu writes: I always open more than 1 R console in Windows. I can't figure out a way to do this with OS X yet. I need that to utilize the duo core on my desktop. How would I do that? Have a look here https://stat.ethz.ch/pipermail/r-sig-mac/2008-April/004814.html

Re: [R] counting number of G in TCGGGGGACAATCGGTAACCCGTCT

Daren Tan daren76 at hotmail.com writes: Any better solution than this ? sum(strsplit(TCGACAATCGGTAACCCGTCT, )[[1]] == G) Try table(strsplit(TCGACAATCGGTAACCCGTCT, )) A C G T 5 7 8 5 and get all 4 at once. HTH -- Ken Knoblauch Inserm U846 Institut Cellule Souche et Cerveau

Re: [R] building experimental paradigm with R as Brainard/Pelli PsychToolbox

and MLDS). Ken -- Ken Knoblauch Inserm U846 Institut Cellule Souche et Cerveau Département Neurosciences Intégratives 18 avenue du Doyen Lépine 69500 Bron France tel: +33 (0)4 72 91 34 77 fax: +33 (0)4 72 91 34 61 portable: +33 (0)6 84 10 64 10 http://www.sbri.fr

Re: [R] grouping values

are separated by | [,1] [,2][1,] aa A|D[2,] bb B[3,] cc C|E How about do.call(expand.grid, rep(list(c(u, l)), 3)) Var1 Var2 Var3 1uuu 2luu 3ulu 4llu 5uul 6lul 7ull 8lll -- Ken Knoblauch Inserm U846

Re: [R] grouping values

Ken Knoblauch ken.knoblauch at inserm.fr writes: Daren Tan daren76 at hotmail.com writes: I tried aggregate, apply etc, but can't get the right result. do.call(expand.grid, rep(list(c(u, l)), 3)) Var1 Var2 Var3 1uuu 2luu 3ulu 4llu 5u

Re: [R] expand.grid() function

Megh Dal megh74 at yahoo.com writes: I have one question on expand.grid() function. When I write following syntax :expand.grid(c(u, l), c(u, l), c(u, l)) I get following as desired : Var1 Var2 Var3 1uuu 2luu 3ulu 4llu 5u

Re: [R] Conditional ploting with logical vector

Armin Goralczyk agoralczyk at gmail.com writes: In a function I have a plot and want to add symbols/text only when indicated by a logical vector (which was generated by the function before, not manually like in the following example): plot(1:10, 1:10) lv - c(T,T,T,F,F,F,T,T,T,F) text(1:10,

Re: [R] help with R semantics

Hi, Charles Annis, P.E. Charles.Annis at StatisticalEngineering.com writes: logit.FC - function(POD.floor = 0, POD.ceiling =1) { if (POD.floor 0 | POD.floor 1) stop (POD.floor must be between zero and one.) if (POD.ceiling 0 | POD.ceiling 1) stop (POD.ceiling must be between zero

Re: [R] Importing an Excel spreadsheet

andy geek_show at dsl.pipex.com writes: I am trying to import an *.xls spreadsheet into R. I am doing this as follows: read.table(file(A5_DL.xls)) So I copied it all over to a text document and tried to import that, thus: read.table(A5.txt) The error I got then was: Error in scan(file,

Re: [R] Overloading %*%

Joe Cainey jcainey at gmail.com writes: Is it possible to supply a new method for the %*% operator? clipped I've tried to do the same thing with %*%: %*%.ad - function(a,b) { # further code here } However this doesn't work; the new method is never called and the standard %*%

Re: [R] [OT] normal (as in Guassian)

Johannes Hüsing johannes at huesing.name writes: Am 02.03.2008 um 17:44 schrieb Gabor Csardi: I'm not a statistician, but do i remember well that among all distributions with a given mean and variance, the normal distribution has the highest entropy? This is good enough for me to call

Re: [R] Loop with variable index

Bill.Venables at csiro.au writes: y - sort(rnorm(20)) # say... m - s - numeric(19) for(i in 2:20) { m[i-1] - mean(y[1:i]) s[i-1] - sd(y[1:i]) } -Original Message- On Behalf Of cvandy Subject: [R] Loop with variable index I have a list of 20 values. The first

Re: [R] color palette from red to blue passing white

hadley wickham h.wickham at gmail.com writes: pruned For example, I have this alpha function in ggplot: alpha - function(colour, alpha) { col - col2rgb(colour, TRUE) / 255 col[4, ] - rep(alpha, length(colour)) new_col - rgb(col[1,], col[2,], col[3,], col[4,]) new_col[is.na(colour)] -

  1   2   >