Re: [R] Help needed with olsrr package

On Thu, 24 Aug 2023 10:56:00 +0530 Ashim Kapoor wrote: > When I open a terminal, type R and run my code, it runs fine. When I > start Emacs, start an inferior R process using ESS, the error comes > back. Thankfully, in both of these cases you get an interactive R session. Compare

Re: [R] Help needed with olsrr package

I copied your data and ran your code. It worked fine for me. > sessionInfo() R version 4.3.1 (2023-06-16) Platform: x86_64-pc-linux-gnu (64-bit) Running under: Ubuntu 22.04.2 LTS Matrix products: default BLAS: /usr/lib/x86_64-linux-gnu/openblas-pthread/libblas.so.3 LAPACK:

Re: [R] Help needed with olsrr package

В Tue, 22 Aug 2023 16:06:22 +0530 Ashim Kapoor пишет: > Error in eval(predvars, data, env) : object 'Var.One' not found Use traceback() to find out in which function the error was raised. This looks like a bug in the olsrr package. Could be due to use of string manipulation in order to work

Re: [R] Help needed to understand an error message produced from furrr and future packages

This question is off-topic here (see the Posting Guide, you are asking about a contributed package). Like walking down the street and asking this question, someone might know about it, but most will be puzzled. You should know that multicore is quite sensitive to which kinds of operations you

[R] Help needed to understand an error message produced from furrr and future packages

Dear R-users I need help to understand the error message from furrr function. I am trying to build a parallel compute system which combines two desktop computers, one of which is a host computer, and runs ubuntu over wsl2, and the other is a slave, which runs ubuntu. as its OS. They are mutually

Re: [R] Help needed with data visualization in R

Hi bharat, There are a number of ways to do this in R. One is: library(plotrix) example(size_n_color) Jim On Tue, Nov 2, 2021 at 6:43 AM bharat rawlley via R-help wrote: > > Thank you very much, for your time and response! > This did resolve my issue and I apologize if the question was a

Re: [R] Help needed with data visualization in R

Thank you very much, for your time and response!  This did resolve my issue and I apologize if the question was a little too straightforward - I did try to create bubble plots in excel but that did not work, hence, I asked here since it is more of a diagram and less of a plot. Thank you very

Re: [R] Help needed with data visualization in R

... a simple web search on "bubble plots R" (what else?) would have brought up many relevant hits. One should always try such obvious "homework" before posting here. Better and quicker info often results. Bert Gunter "The trouble with having an open mind is that people keep coming along and

Re: [R] Help needed with data visualization in R

I have no experience with this but I did a search and found the following which looks close to what you are looking for https://stackoverflow.com/questions/69755844/is-it-possible-to-draw-the-following-diagram-in-r On Mon, Nov 1, 2021 at 5:06 PM bharat rawlley via R-help <

[R] Help needed with data visualization in R

Hello,  I wanted to ask if it is possible to have a data visualization of the following kind in R?  It is not exactly a graph; a series of bubbles that have an area corresponding to the percentage inside it arranged in a row.  Thank you!  __

Re: [R] Help needed with getting a decent image of ggplot2 graph

If they can't work out how to resize an image, a 300 dpi resolution leaves you with an image a bit over 37 mm wide. Doesn't add up for me. Jim On Wed, Aug 25, 2021 at 10:00 AM bharat rawlley wrote: > > I tried doing that. > > So the real title of my graph is much longer than men and women and

Re: [R] Help needed with getting a decent image of ggplot2 graph

I tried doing that.  So the real title of my graph is much longer than men and women and isn't not being incorporated in that width.  I think I'll have to settle for a smaller title  Sent from Yahoo Mail on Android On Tue, 24 Aug 2021 at 6:54 PM, Jim Lemon wrote: Ah, an _upper_ limit.

Re: [R] Help needed with getting a decent image of ggplot2 graph

Ah, an _upper_ limit. Why not let tiff() work out the resolution (res=NA - the default) and see if that passes muster. Jim On Wed, Aug 25, 2021 at 8:42 AM bharat rawlley wrote: > > I am able to change but the place where I have to submit a similar graph has > kept a fixed upper limit of 440

Re: [R] Help needed with getting a decent image of ggplot2 graph

I am able to change but the place where I have to submit a similar graph has kept a fixed upper limit of 440 pixels for the width and an upper limit of 300 for the dpi. On Tuesday, 24 August, 2021, 06:36:16 pm GMT-4, Jim Lemon wrote: Hi bharat, I think there is a conflict between

Re: [R] Help needed with getting a decent image of ggplot2 graph

Hi bharat, I think there is a conflict between your image size and resolution. You need a lot larger height and width in pixels to get 300 dpi resolution for the whole plot. tiff("test.tiff", units = "px", width = 2200, height = 1250, res = 300) would probably do it for you. How come you can't

[R] Help needed with getting a decent image of ggplot2 graph

Hello, I made the following graph in R with the following code. ggplot(aes(x=factor(year), y=percentage, color = Gender, fill=Gender), data = graph_text)+  geom_bar(position = 'dodge', stat='identity')+  theme_classic()+  scale_y_continuous(limits=c(0, 1.4*ymax))+  labs(x= 'Year', y =

Re: [R] Help needed with ggplot2

cumented ways. Bold text is an example that can be changed in many places. In this case, note the addition to the following part from above: fontface="bold as in: geom_text(aes(label = percentage), size = 4, position = position_dodge(width = 1.1), vjust=-0.2,

Re: [R] Help needed with ggplot2

Thank you, I have tried to do a better job here -  Data -  email <- structure(list(percentage = c(57.14, 29.76, 69.32, 28.41, 57.89,                                        34.21, 58.59, 33.33, 48.42, 42.11, 59.77, 29.89, 72.13, 18.03,                                        53.33, 33.33,

Re: [R] Help needed with ggplot2

See ?dput for how to provide a reproducible example (a reprex). Or see here: https://stackoverflow.com/questions/5963269/how-to-make-a-great-r-reproducible-example It will improve your chance of getting a helpful and quick response. Cheers, Bert Gunter "The trouble with having an open mind is

[R] Help needed with ggplot2

Hello, on using the following code for the following data, the graph I get has an x axis where years are mentioned as 2012.5, 2017.5 etc.  I have the following questions -  Q1 How can I make the years on x axis as 2011, 2012, 2013, 2014 and so on..  Q2 Is there any way to create a small gap

Re: [R] Help needed in double bar plot made using ggplot2

Thanks Dr. Burradas too. i also had the same question. regards August 20, 2021 6:02 AM, "bharat rawlley via R-help" wrote: > Thank you, Dr. Burradas! > That resolved my query > Have a great rest of your day > On Thursday, 19 August, 2021, 04:47:42 pm GMT-4, Rui Barradas > wrote: >

Re: [R] Help needed in double bar plot made using ggplot2

Thank you, Dr. Burradas!  That resolved my query Have a great rest of your day On Thursday, 19 August, 2021, 04:47:42 pm GMT-4, Rui Barradas wrote: Hello, Glad it helped. As for making everything red, that only happens with the 2nd geom_text I posted. And this is because color =

Re: [R] Help needed in double bar plot made using ggplot2

Hello, Glad it helped. As for making everything red, that only happens with the 2nd geom_text I posted. And this is because color = "red" is not in aes(). In the 1st geom_text, I have aes( etc , color = gender) and this makes the color depend on gender. To make the text and bars colors the

Re: [R] Help needed in double bar plot made using ggplot2

Thank you very much for the elaborate response, Dr. Barradas! It was extremely helpful!  This resolves all my queries except one; I am unable to assign aesthetic colors in a way that the bar and text colors remain the same. I am not sure how to exactly assign color outside of aes. I used the

Re: [R] Help needed in double bar plot made using ggplot2

Hello, First, sample data. set.seed(2021) year <- rep(2016:2019, 2) percentage <- runif(length(year), 0.25, 0.70) gender <- rep(c("M", "F"), each = 4) graph_text <- data.frame(year, percentage, gender) 1) You have expand = c(0,0). Like this there is no space above the greatest bar. In order

[R] Help needed in double bar plot made using ggplot2

Hello I have tried to create the following graph using ggplot2 using the following code -  ggplot(aes(x=year, y=percentage, group=gender, fill=gender), data = graph_text)+  geom_bar(position = 'dodge', stat='identity')+  scale_y_continuous(expand = c(0,0))+  theme_classic()+ 

Re: [R] Help needed with gender_df

That was helpful, thank you very much!  On Sunday, 1 August, 2021, 01:49:30 pm GMT-4, Rui Barradas wrote: Hello, According to the documentation, This function predicts the gender of a first name given a year or range of years in which the person was born. and your data does not

Re: [R] Help needed with gender_df

Hello, According to the documentation, This function predicts the gender of a first name given a year or range of years in which the person was born. and your data does not include first names, only names in a form similar to Last First_name_initial. This function/package is not

[R] Help needed with gender_df

Hello,  when using the following code -  gender_df(Test1, name_col = "First", year_col = "Year") for the file attached below, I get the following result -  # A tibble: 0 x 6# ... with 6 variables: name , proportion_male , proportion_female , gender ,#   year_min , year_max | First | |

Re: [R] - Trying to replicate VLOOKUP in R - help needed

I will do that... Thanks again Jeff. r/ Gregg Powell ‐‐‐ Original Message ‐‐‐ On Wednesday, November 18, 2020 8:36 AM, Jeff Newmiller wrote: > Instead, learn how to use the merge function, or perhaps the dplyr::left_join > function. VLOOKUP is really not necessary. > > On

Re: [R] - Trying to replicate VLOOKUP in R - help needed

Instead, learn how to use the merge function, or perhaps the dplyr::left_join function. VLOOKUP is really not necessary. On November 18, 2020 7:11:49 AM PST, Gregg via R-help wrote: >Thanks Andrew and Mitch for your help. > >With your assistance, I was able to sort this out. > >Since I have to

Re: [R] - Trying to replicate VLOOKUP in R - help needed

Thanks Andrew and Mitch for your help. With your assistance, I was able to sort this out. Since I have to do this type of thing of often, and since there is no existing package/function (yet) that makes this easy, if ever I get to the point were I develop enough skill to build and submit a new

Re: [R] - Trying to replicate VLOOKUP in R - help needed

ASSIGNED_COMPANY[grep("ADELPHI",NAME)] <-"NEC ADELPHI" is what I'd try On Mon, Nov 16, 2020 at 4:27 PM Andrew Robinson wrote: > Hi Gregg, > > it's not clear from your context if all of ASSIGNED _COMPANY is NA or what > the classes of the objects are. Try the following ideas, none of which are

Re: [R] - Trying to replicate VLOOKUP in R - help needed

Hi Gregg, it's not clear from your context if all of ASSIGNED _COMPANY is NA or what the classes of the objects are. Try the following ideas, none of which are tested. I assume that the data set is called location. location$ASSIGNED_COMPANY <- as.character(location$NAME) is.a.FORT <-

[R] - Trying to replicate VLOOKUP in R - help needed

PROBLEM: I am trying to replicate something like a VLOOKUP in R but am having no success - need a bit of help. GIVEN DATA SET (data.table): (looks something like this, but much bigger) NAME TOTALAUTH ASSIGNED_COMPANY ABERDEEN PROVING GROUND 1 NA

Re: [R] Help needed: gdal-configuration to install sf package in Mac OS Catalina

On 4/5/20 9:27 PM, Bijesh Mishra wrote: Hi, I am using R in Mac. I was trying to install sf package but could not and got error. Detail message of error is under this email. It seems like I have to run gdal- configuration, but not sure what that means. Do you have any idea about that? GDAL

Re: [R] Help needed: gdal-configuration to install sf package in Mac OS Catalina

On Sun, 5 Apr 2020 23:27:08 -0500 Bijesh Mishra wrote: > configure: error: gdal-config not found or not executable. This would mean that gdal [1], which is a dependency of the sf package, is not installed (or not available on $PATH, or...). If you use Homebrew [2], try running 'brew install

[R] Help needed: gdal-configuration to install sf package in Mac OS Catalina

Hi, I am using R in Mac. I was trying to install sf package but could not and got error. Detail message of error is under this email. It seems like I have to run gdal- configuration, but not sure what that means. Do you have any idea about that? This is the message I got while installing SF

Re: [R] Help needed for one question (Urgent)

Dear All, Thanks for all the support and help and I think I was able to solve my problem. Thanks a ton. Best Regards, Chandeep Kaur On Tue, 5 Nov 2019, 8:57 pm Richard O'Keefe, wrote: > This looks vaguely like something from exercism. > Let's approach it logically. > xa xb xc ya yb zc > We

Re: [R] Help needed for one question (Urgent)

This looks vaguely like something from exercism. Let's approach it logically. xa xb xc ya yb zc We see two patterns here: A: x x x y y z B: a b c a b c If only we had these two character vectors, we could use paste(A, B, sep = "") to get the desired result. So now we have reduced the problem

Re: [R] Help needed for one question (Urgent)

In other words... read the Posting Guide. On November 5, 2019 2:52:34 AM PST, Jim Lemon wrote: >Homework Chandeep, homework. > >Jim > >On Tue, Nov 5, 2019 at 9:40 PM Chandeep Kaur >wrote: >> >> Dear Team, >> >> Could you please help me with the below question? How can I get the >desired >>

Re: [R] Help needed for one question (Urgent)

Homework Chandeep, homework. Jim On Tue, Nov 5, 2019 at 9:40 PM Chandeep Kaur wrote: > > Dear Team, > > Could you please help me with the below question? How can I get the desired > output? > > Produce the following sequence using only rep(), seq() and potentially > other functions/operators.

[R] Help needed for one question (Urgent)

Dear Team, Could you please help me with the below question? How can I get the desired output? Produce the following sequence using only rep(), seq() and potentially other functions/operators. You must not use c() nor explicit loops “xa” “xb” “xc” “ya” “yb” “zc” Thanks & Regards, Chandeep

Re: [R] Help needed with eval parse

That worked! Thanks for the explanation. On Wed, Sep 18, 2019 at 10:06 AM Duncan Murdoch wrote: > > On 18/09/2019 8:43 a.m., Huzefa Khalil wrote: > > Hello R-users, > > > > I have been running a script which produces objects based on the > > column names of a data.frame. The column names are of

Re: [R] Help needed with eval parse

On 18/09/2019 8:43 a.m., Huzefa Khalil wrote: Hello R-users, I have been running a script which produces objects based on the column names of a data.frame. The column names are of the form CB_1-1, CB_1-2, etc. Now this calculation was rather long and memory intensive, so I would rather not have

[R] Help needed with eval parse

Hello R-users, I have been running a script which produces objects based on the column names of a data.frame. The column names are of the form CB_1-1, CB_1-2, etc. Now this calculation was rather long and memory intensive, so I would rather not have to do it again after fixing the column names

Re: [R] Help needed with my code for merging multiple xls files from google drive

Your example is not reproducible [1][2][3], you are reposting a copy of an email in a fresh thread (instead of replying to the first one), and you are using HTML email format on a text-only mailing list (what you see is really not what we see). Please read the Posting Guide to find out what the

[R] Help needed with my code for merging multiple xls files from google drive

Hi guys, I am trying to merge a list of .xls files in google drive. I have now managed to create a list of all the files I need, but for some reason I still can't manage to merge them, this is the code I have so far: library(googledrive) inputfiles <- drive_ls(path = "Email It In", pattern =

[R] Help needed regarding dlm model on stats.stackexchange

Dear all, I have created a time varying parameters regression. When I do that I have a parameter which is AR1. I am not able to recover this parameter. My query is posted here : https://stats.stackexchange.com/questions/377295/unable-to-recover-time-varying-ar1-parameter-from-state-space-model

Re: [R] help needed on RcppEigen....

For loops are not usually the primary cause of slow processing in R... poor memory handling is. But the closest you seem to come to asking a question in your email seems to be about Rcpp, which is off topic on this mailing list. Try reading all of the Rcpp vignettes, and then if needed ask on

Re: [R] help needed on quantmod....

Hello, How are you calling your function? Can you show us the actual code? I am testing it like the following. apnd(list("IBM")) Error in download.file(paste("https://finance.yahoo.com/d/quotes.csv?s=;, : cannot open URL 'https://finance.yahoo.com/d/quotes.csv?s=IBM=d1t1l1c1p2ohgv' In

Re: [R] Help needed with aggregate or other solution

Hi Thomas, Would this work: res1=aggregate(dta[,"fcst"],by=list(basistime=dta[,"basistime"]),FUN=max) mm=match(paste(res1[,"basistime"],res1[,"x"]),paste(dta[,"basistime"],dta[,"fcst"])) dta[mm,] > dta[mm,] date basistime fcst usgs 20 2012-01-30 12:00:00 2012-01-25

Re: [R] Help needed with aggregate or other solution

On 10/26/2017 4:58 AM, Thomas Adams wrote: Hi Jeff, Thank you for the suggestions -- I appreciate your help. Unfortunately, the result2 has two problems... (1) there are now 3 date columns (it looks like 2 cols are merged into 1 col) (2) the output rows should not have any of the basistime

Re: [R] Help needed with aggregate or other solution

On Thu, 26 Oct 2017, Thomas Adams wrote: Hi Jeff, Thank you for the suggestions -- I appreciate your help. Unfortunately, the result2 has two problems... (1) there are now 3 date columns (it looks like 2 cols are merged into 1 col) No, there are two date columns. Result2 includes the

Re: [R] Help needed with aggregate or other solution

Hi Jeff, Thank you for the suggestions -- I appreciate your help. Unfortunately, the result2 has two problems... (1) there are now 3 date columns (it looks like 2 cols are merged into 1 col) (2) the output rows should not have any of the basistime dates repeated (maybe I misstated the problem);

Re: [R] Help needed with aggregate or other solution

Thanks for the dput... reproducible example of split-apply-combine ### dta <- structure(list(date = structure(c(1L, 2L, 3L, 4L, 5L, 6L, 7L, 8L, 9L, 10L, 11L, 12L, 13L, 14L, 15L, 16L, 17L, 18L, 19L, 20L, 5L, 6L, 7L, 8L, 9L, 10L, 11L, 12L, 13L, 14L, 15L, 16L, 17L, 18L, 19L, 20L, 21L, 22L,

[R] Help needed with aggregate or other solution

Hello all! I've been struggling with is for many hours today; I'm close to getting what I want, but not close enough... I have a dataframe consisting of two date-time columns followed by two numeric columns. what I need is the max value (in the first numeric column) based on the 2nd date-time

Re: [R] help needed for RInside with Qt

Hi Bert and Jeff, Thanks a lot for pointing it out. It is a commercial application. I would be distributing it. This makes R out of consideration. Thanks again for saving much time and effort. On Thu, Jun 29, 2017 at 10:22 AM, Jeff Newmiller wrote: > If you adhere to

Re: [R] help needed for RInside with Qt

If you adhere to the terms of the license for R you should be okay legally. If you use contributed packages they may have additional requirements. However, these terms are often overlooked by programmers targeting Windows, hence Bert's caution. As to the content of the original post itself,

Re: [R] help needed for RInside with Qt

Is this application meant to be commercial? If so, R's open source license probably would forbid you to use it. I defer to those with real legal knowledge on this point, but you should check it. If it is not meant to be commercial, then ignore -- I have nothing useful to offer you. Cheers, Bert

[R] help needed for RInside with Qt

Hello, I am developing an application using Qt framework and C++. I want to use R as statistics engine of my application. After doing some search on internet; I came to the conclusion that RCPP, MPI with RInside is what I need. The next logical task was to quickly tryout "qtdensity" project of

Re: [R] R help needed

> On Jun 23, 2016, at 9:50 AM, Sana Fatima wrote: > > Hello everyone, > I am trying to create an shiny app that could be used for ~ 700 different > user names and passwords. Each username and password would lead to a > different set of data being pulled in, however the tabs

[R] R help needed

Hello everyone, I am trying to create an shiny app that could be used for ~ 700 different user names and passwords. Each username and password would lead to a different set of data being pulled in, however the tabs and fields with in the app will be the same. Just that different username would

Re: [R] Help needed to format data for boxplot time-series

rg] On Behalf Of Thomas > > Adams > > Sent: Wednesday, June 1, 2016 2:07 PM > > To: r-help@r-project.org > > Subject: [R] Help needed to format data for boxplot time-series > > > > All: > > > > I have used R in combination with GRASS GIS spatial data

Re: [R] Help needed to format data for boxplot time-series

r-help-boun...@r-project.org] On Behalf Of Thomas > Adams > Sent: Wednesday, June 1, 2016 2:07 PM > To: r-help@r-project.org > Subject: [R] Help needed to format data for boxplot time-series > > All: > > I have used R in combination with GRASS GIS spatial data (using spg

[R] Help needed to format data for boxplot time-series

All: I have used R in combination with GRASS GIS spatial data (using spgrass) many times in the past to generate a 'time series' of boxplots, to show variations over time. But I have a new problem, not involving spatial data, but rather, true time-series data (snippet shown below). So, what I

Re: [R] Help needed with successfully downloading and opening Agricolae package

Thanks Sarah, downloaded the sp package separately and that resolved the error. > On May 6, 2016, at 5:43 PM, David Winsemius wrote: > > >> On May 6, 2016, at 1:41 PM, Sarah Goslee wrote: >> >> On Fri, May 6, 2016 at 4:33 PM, Jeff Newmiller

Re: [R] Help needed with successfully downloading and opening Agricolae package

> On May 6, 2016, at 1:41 PM, Sarah Goslee wrote: > > On Fri, May 6, 2016 at 4:33 PM, Jeff Newmiller > wrote: >> I am puzzled why the original install.packages call did not also download >> the sp package, since the default argument

Re: [R] Help needed with successfully downloading and opening Agricolae package

On Fri, May 6, 2016 at 4:33 PM, Jeff Newmiller wrote: > I am puzzled why the original install.packages call did not also download > the sp package, since the default argument dependencies = NA should have > triggered installation of imports including spDep, which should

Re: [R] Help needed with successfully downloading and opening Agricolae package

I am puzzled why the original install.packages call did not also download the sp package, since the default argument dependencies = NA should have triggered installation of imports including spDep, which should in turn have installed the dependencies including the sp package. Anyone have a

Re: [R] Help needed with successfully downloading and opening Agricolae package

This is a plain-text email list, so your red doesn't show up, but since the error message said that the installer couldn't find the sp package, I'd start by installing that. Sarah On Fri, May 6, 2016 at 12:35 PM, Phillips,Douglas A wrote: > Hi, I just downloaded the Agricolae

[R] Help needed with successfully downloading and opening Agricolae package

Hi, I just downloaded the Agricolae package and tried to access it using the commands listed below (and received the error messages in red). Any suggestions on resolving these errors? Thanks for your assistance. Doug > install.packages("agricolae") % Total% Received % Xferd Average

Re: [R] Help needed in data cleaning

Hi Nash, If I understand your question correctly, you want the "mice" package. Hopefully you have more data than your example. Jim On Sat, Dec 19, 2015 at 6:14 AM, Web Web wrote: > Hello, >I need some help in data cleaning using R. my CSV file looks as >

Re: [R] Help needed in data cleaning

; To: r-help@r-project.org > Subject: [R] Help needed in data cleaning > > Hello, >I need some help in data cleaning using R. my CSV file looks > as > follows. > > "id","gender","age","category1","category2"

[R] Help needed in data cleaning

Hello, I need some help in data cleaning using R. my CSV file looks as follows.

Re: [R] Help needed in plotting 2d histogram

Hi Saikat, I don't know whether this can be done with ggplot, but if you don't get another answer, have a look at the second example for the "barp" function in the plotrix package. This shows how to get a specified range on the color legend using the "xrange" argument. Jim On Fri, Dec 18, 2015

[R] Help needed in plotting 2d histogram

Hello. I have more than one phi-psi time series data files each having 5 time points. I am trying to create density plots (2d histograms) for each and then I would like to compare them. But to be able to compare one plot with the other I need to have similar colour densities (i.e colour

[R] Help needed with Traininig a Neural Network

I am attempting to train a dataset but am having a hard time. I am using a dataset from UCI *archive.ics.uci.edu/ml/datasets/Congressional+Voting+Records http://archive.ics.uci.edu/ml/datasets/Congressional+Voting+Records *. I am attempting to replicate a study which predicts the political party

[R] help needed with printing multiple arguments as vectors, not matrices

** I am using the following way to get p-values from fiser exact test. However, I do need to print for each pair the values n00, n01, n10, n11. How can I print that as a table and not a matrix as below along with the p-value? Any help will be greatly appreciated fish - function(y, x) {n00 =

Re: [R] help needed with printing multiple arguments as vectors, not matrices

Could you provide an example of mat1 and mat2 as well as an example of the output you would like from them. Your code is very difficult to follow as written. It will be easier for readers of the list to interpret if you use carriage returns rather than semi colons, for example ... fish -

Re: [R] help needed with printing multiple arguments as vectors, not matrices

Sample data is as follows (for simplicity assume mat1 and mat2 are the same matrices). Also attached as an excel file. I want to get the pairwise interaction fischer test results. Not just the pvalues but also want to wrote the n00, n01, n10 and n11 in the file as: ADCK2_mat1 ADCK3_mat2 n00 n01

Re: [R] help needed with printing multiple arguments as vectors, not matrices

When sharing data, use dput() to output the data in a way that R-Help readers can easily use. Give this code a try and see if it helps. Jean # read in the example data mat1 - structure(list(GENE SYMBOL = c(ADCK2, ADCK3, ADCK4, ADCK5, ADRBK1, ADRBK2, AKT1, AKT2, AKT3, ALK), Sample.A1.A0SK.01

Re: [R] help needed with printing multiple arguments as vectors, not matrices

Awesome! Thanks so much for your help. I am able to get the format I was looking for. On Mon, Jun 24, 2013 at 2:50 PM, Adams, Jean jvad...@usgs.gov wrote: When sharing data, use dput() to output the data in a way that R-Help readers can easily use. Give this code a try and see if it helps.

Re: [R] Help needed in feature extraction from two input files

Hi, Try this: lines1- readLines(textConnection(gene1 or1|1234 or3|56 or4|793 gene4 or2|347 gene5 or3|23 or7|123456789)) lines2-readLines(textConnection(or1|1234 ATCGGATTCAGG or2|347 GAACCTATCAATTTATATAA or3|56 ATCGGAGATATAACCAATC or3|23 TTAACAAGAGAATAGACAAA or4|793

Re: [R] Help needed in feature extraction from two input files

Hi, Try this: lines1- readLines(file1.txt) lines1- lines1[lines1!=] #In file2.txt, or1|1234 ATCGGATTCAGG or2|347 GAACCTATCAATTTA TATAA###this should be a single line or3|56 ATCGGAGATATAACCAATC or3|23 TTAACAAGAGAATAGACAAA or4|793 ATCTCTCTCCTCTCTCTCTA or7|123456789

Re: [R] help needed! RMSE

mansor nad nadsim88 at hotmail.com writes: i need HELPPP!! how do i calculate the RMSE value for two GEV models?first GEV is where the three parameters are constant.2nd GEV model a 4 parameter model with the location parameter is allowed to vary linearly with respect to time while holding

[R] help needed! RMSE

i need HELPPP!! how do i calculate the RMSE value for two GEV models?first GEV is where the three parameters are constant.2nd GEV model a 4 parameter model with the location parameter is allowed to vary linearly with respect to time while holding the other parameters at constant. is there any

[R] Help needed

Hello, i can't find a test for elliptical symmetry In R, is there any package that can save me the trouble ?Thank you in advanceSincerely yoursSleiman [[alternative HTML version deleted]] __

Re: [R] help needed in least square curve fit equation

As I understand, it is an optimization problem. LeastSquare=sum[y-f(x)]^2 Minimize least square by solving equations about a, b, and c. An iterative method could be developed to get the result or some R functions might be found useful. Please refer

[R] Help needed with data format required for package VIF

Hallo Could somebody perhaps assist with my dilemma, Package: VIF. The examples are not very clear (data is stored internally). I wish to read a .csv file (header=TRUE) and run VIF. But I get nonsensical output. I have downloaded the boston.csv file (from the referring website). How do I

Re: [R] Help needed on parallel processing

Le mercredi 26 septembre 2012 à 13:04 +0530, Anindya Sankar Dey a écrit : Hi All, If i have a vector say x-1:10 and then use parLapply(cl,x,function(k){k=k*2; return(k);} it works and will also parallel process depending on the number of cores and the number of clusters I've built in

[R] Help needed in reading matlab files

Dear users, I am stucked with a programming problem: I am trying to download a squared adjacency matrix from matlab with only 0 or 1. Doing it without a loop at first, I get an error message that is, I think, related to the mat_adj-readMat(pathnames_adj) line. Did anybodz encouter already

Re: [R] Help needed in reading matlab files

Hello, I don't have MATLAB here so this is completely untested but the help page for readMat says: Arguments |con| Binary |connection http://127.0.0.1:11101/library/base/html/connections.html| to which the MAT file structure should be written to. A string is interpreted as

Re: [R] Help needed in reading matlab files

Sorry, it's adj_con - file(pathnames_adj, open = rb) Rui Barradas Em 14-08-2012 19:12, Rui Barradas escreveu: Hello, I don't have MATLAB here so this is completely untested but the help page for readMat says: Arguments |con| Binary |connection

[R] Help needed with Krig and predict

Hello everybody! I have a problem, which I'm trying to solve. I have two Krig-fits: kr_one and kr_two; both use x and y and additional either A (kr_one) or B (kr_two): kr_one - with(1, Krig(cbind(x,y), A)) kr_two - with(1, Krig(cbind(x,y), B)) I can view the 3d-plane using:

[R] Help needed to tackle multicollinearity problem in count data with the help of R

Dear everyone, I'm student of Masters in Statistics (Actuarial) from Central University of Rajasthan, India. I am doing a major project work as a part of the degree. My major project deals with fitting a glm model for the data of car insurance. I'm facing the problem of multicollinearity for this

Re: [R] Help needed to tackle multicollinearity problem in count data with the help of R

Dear Umesh Khatri, The vif() function in the car package will compute (generalized) variance inflation factors for GLMs. What (if anything) to do about collinearity isn't in my opinion an answerable question without knowing the details of your research. In particular, ridge regression is not

[R] Holt Winters in R - Help needed

on this please? I really need it urgent. All my values corresponds to one single time point. -- View this message in context: http://r.789695.n4.nabble.com/Holt-Winters-in-R-Help-needed-tp4632816.html Sent from the R help mailing list archive at Nabble.com. __ R

Re: [R] Holt Winters in R - Help needed

the problem, but can anyone help me on this please? I really need it urgent. All my values corresponds to one single time point. -- View this message in context: http://r.789695.n4.nabble.com/Holt-Winters-in-R-Help-needed-tp4632816.html Sent from the R help mailing list archive at Nabble.com

[R] Help needed for this error

results - mra(x$w1mcp, filter = d4, n.levels = 3, boundary = periodic, method = dwt) write.csv(results, c:/mydata.csv) Error in as.data.frame.default(x[[i]], optional = TRUE) : cannot coerce class 'structure(mra, package = wavelets)' into a data.frame I am not able to access data stored in

  1   2   3   >