Re: [freenet-support] seednodes.ref abnormally large?
-BEGIN PGP SIGNED MESSAGE- Hash: SHA1 Mika Hirvonen randomly hit the keyboard and managed to write on 21/03/2004 21:38: Max Moritz Sievers wrote: On Sunday 21 March 2004 13:28, Niklas Bergh wrote: You mean like we do with http://freenetproject.org/snapshots/seednodes.ref.bz2 That's nice to know but update.sh doesn't use it. So I guess most Freenet-users download the big uncompressed file. Yes, it does. The code to download and uncompress the bzipped seednodes has been there since January. Try downloading http://www.freenetproject.org/snapshots/freenet-latest.tgz, it should contain the latest version of update.sh. However, the version that is pulled down by Fred and placed into the distrib folder doesn't. update.sh #!/bin/bash wget http://freenetproject.org/snapshots/freenet-latest.jar -O freenet.jar wget http://freenetproject.org/snapshots/seednodes.ref -O seednodes.ref touch -d "1/1/1970" seednodes.ref # so we don't reseed unless necessary I have re-written it thus... update.sh #!/bin/bash # make sure we only get the newest versions. wget -N http://freenetproject.org/snapshots/freenet-latest.jar wget -N http://freenetproject.org/snapshots/seednodes.ref.bz2 # Use copy so that we keep the original name (could use ln -s) # for later retrieval comparison. cp freenet-latest.jar freenet.jar # Unpack seednodes.ref but keep the original bz2 for later # retrieval comparison. bzip2 -dkf seednodes.ref.bz2 touch -d "1/1/1970" seednodes.ref # so we don't reseed unless necessary Richard - -- CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCGCGCACTTATGCCTCAATAGATCTGCCACATCG CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGAAGTGTGGCATCCGCTTCAG dna.pl v0.2.4 (c) 20020613 (tm) rich at mibnet.plus.com -BEGIN PGP SIGNATURE- Version: GnuPG v1.2.3-nr1 (Windows XP) Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org iD8DBQFAXjNuDehCPPrjI9gRAhe1AKCs9QRZYPe6NgJN3G5mt7DYvsqVRQCfQ6ml 6augNmx491TL4EZfhHGjcjU= =vu11 -END PGP SIGNATURE- -- -- This message has been swept clean of viruses by AVG Anti Virus email Scanner. http://www.grisoft.com/html/us_index.cfm Checked by AVG anti-virus system (http://www.grisoft.com). Version: 6.0.627 / Virus Database: 402 - Release Date: 22/03/2004 ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] Route not found - stability next generationrouting
> 2) Even after having the node up for a wile and(!) > successfully downloading content, the node more often > fails to route the request to other nodes than before > NG-routing. Wihtout NG routing I was able to have > request returned with 25 HTL with a "data not found" > error - a clear indication that the data was not there > for sure. With NG routing I am having trouble to get a > data-not found message at all, most of the errors I > only get "route not found" with 1 or 2 nodes or even 0 > being contacted. This is probably due to the recent Rate limiting facilites more than to NGRouting.. Ratelimiting will cause RNFs when your node overloads it neighbours with requests.. > Now to my questions: > a) is there a way to make my freenet node try to > contact NEW nodes more often? For example by more > aggressivle cleaning up the routing table? Well.. you could try increasing the size of the routing table maybe.. > b) How can I tweak routing that my node (AFTER > successfully receiving data!) does no longer think, it > does no know where to deliver the requests to? > c) Why does my node deliver "route not found" errors > with onlny a few (<< 5) other nodes it tried to > contact? How can I make it contact more nodes? (> 20) This probably is partly due to a bug or two..however.. there might also be valid reasons for this behaviour..it is not impossible that your node doesn't _have_ any more nodes to contact (your node might have reached its request quota for all other nodes it knows about for instance etc.) > d) Do nodes tell each other about the nodes they know? Yes.. information about other, new nodes are passed along within certain freenet messages. > e) is it easy to get involved in the freenet > development? Yes, quite easy.. however.. the code isn't eceptionally well documented.. /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] seednodes.ref abnormally large?
Max Moritz Sievers wrote: On Sunday 21 March 2004 13:28, Niklas Bergh wrote: You mean like we do with http://freenetproject.org/snapshots/seednodes.ref.bz2 That's nice to know but update.sh doesn't use it. So I guess most Freenet-users download the big uncompressed file. Yes, it does. The code to download and uncompress the bzipped seednodes has been there since January. Try downloading http://www.freenetproject.org/snapshots/freenet-latest.tgz, it should contain the latest version of update.sh. -- Mika Hirvonen <[EMAIL PROTECTED]> http://nightwatch.mine.nu/ ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] seednodes.ref abnormally large?
On Sunday 21 March 2004 13:28, Niklas Bergh wrote: > You mean like we do with > http://freenetproject.org/snapshots/seednodes.ref.bz2 That's nice to know but update.sh doesn't use it. So I guess most Freenet-users download the big uncompressed file. BTW: I'm on the list. with regards, Max Moritz Sievers ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] seednodes.ref abnormally large?
S wrote: 1MB doesn't sound unusual. 905 distinct nodes in 1MB's worth of space does sound unusual. What's the date on your seednodes.ref? 12th October 2003... that does seem a bit old. Maybe it's using the classic routing scheme, with no estimators. Looking at http://freenetproject.org/snapshots/seednodes.ref I notice that there are lines like Estimator.epDNF.Store.d.Key=00d8e5dde97ac2f83d9b80f457aa744a38b1d8de8253833f Estimator.epDNF.Store.d.Time=3f1c562a Which are NOT present in my seednodes.ref. Now I have no idea what estimators are (bit of a newbie), but it does look like I'm not using them. Maybe you're counting the entries incorrectly? Each one has 12 lines, 10860 lines in total, 10860/12=905. Didn't check every entry had 12 lines, but if definitely looked like it. Unless you're having connection problems, I'd ignore it. If you are having connection problems, shut down your node, delete the lsnodes_a, lsnodes_b, ngrt_global_a, ngrt_global_b, rtnodes_a, rtnodes_b, rtprops_a, and rtprops_b files from your Freenet directory, download the latest seednodes.ref from http://freenetproject.org/snapshots, and restart your node. Well I wasn't really having too many problem, but I did that anyway, as my seednodes.ref does seem to be in the old format. Thanks, Michal. ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] seednodes.ref abnormally large?
1MB doesn't sound unusual. 905 distinct nodes in 1MB's worth of space does sound unusual. What's the date on your seednodes.ref? Maybe it's using the classic routing scheme, with no estimators. Maybe you're counting the entries incorrectly? I just checked the 1.9MB seednodes.ref in snapshots, $ lynx --dump http://freenetproject.org/snapshots/seednodes.ref | grep "physical.tcp" | wc -l 130 And my local node references file (2MB), $ lynx --dump http://stable.frnt.net/noderefs.txt | grep "physical.tcp" | wc -l 129 So ~2 megs, ~130 nodes, not necessarily distinct. That seems about average as of late. 905 refs in 1MB does sound weird. Unless you're having connection problems, I'd ignore it. If you are having connection problems, shut down your node, delete the lsnodes_a, lsnodes_b, ngrt_global_a, ngrt_global_b, rtnodes_a, rtnodes_b, rtprops_a, and rtprops_b files from your Freenet directory, download the latest seednodes.ref from http://freenetproject.org/snapshots, and restart your node. -s On Sun, 21 Mar 2004 09:52:27 + Michal Charemza <[EMAIL PROTECTED]> wrote: > Hi, > > My seednodes.ref is nearly 1mb in size, with (I worked out) 905 entries > in it. I've downloaded a couple from freenet, and they're both a lot > smaller, with about 50 entries. The one from Reskill has 49 entries. Is > the size of my seednodes.ref normal? I'm using build 5076. > > Thanks, > > Michal. > ___ > Support mailing list > [EMAIL PROTECTED] > http://news.gmane.org/gmane.network.freenet.support > Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support > Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] seednodes.ref abnormally large?
Max Moritz Sievers wrote: This bings me to mind why don't we compress the http://freenetproject.org/snapshots/seednodes.ref with gzip or bzip2? We do. -- Mika Hirvonen <[EMAIL PROTECTED]> http://nightwatch.mine.nu/ ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] seednodes.ref abnormally large?
You mean like we do with http://freenetproject.org/snapshots/seednodes.ref.bz2 :) /N - Original Message - From: "Max Moritz Sievers" <[EMAIL PROTECTED]> To: <[EMAIL PROTECTED]> Sent: Sunday, March 21, 2004 12:21 PM Subject: Re: [freenet-support] seednodes.ref abnormally large? > This bings me to mind why don't we compress the > http://freenetproject.org/snapshots/seednodes.ref with gzip or bzip2? > > with regards, > Max Moritz Sievers > > ___ > Support mailing list > [EMAIL PROTECTED] > http://news.gmane.org/gmane.network.freenet.support > Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support > Or mailto:[EMAIL PROTECTED] > ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] seednodes.ref abnormally large?
Ok... seing that the seednodes.ref on the snapshot site is 2.5 mb, maybe my 1 mb isn't that big. ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] seednodes.ref abnormally large?
This bings me to mind why don't we compress the http://freenetproject.org/snapshots/seednodes.ref with gzip or bzip2? with regards, Max Moritz Sievers ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
[freenet-support] seednodes.ref abnormally large?
Hi, My seednodes.ref is nearly 1mb in size, with (I worked out) 905 entries in it. I've downloaded a couple from freenet, and they're both a lot smaller, with about 50 entries. The one from Reskill has 49 entries. Is the size of my seednodes.ref normal? I'm using build 5076. Thanks, Michal. ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
