RE: [freenet-support] 5098 Errors sendingPacket == null!
Actually, it seems to have started getting better now.. I haven't seen any of those messages for a while in the log. /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Toad Sent: den 23 oktober 2004 13:25 To: [EMAIL PROTECTED] Subject: Re: [freenet-support] 5098 Errors sendingPacket == null! Argh. As usual it doesn't happen for me, so I can't fix it : On Sat, Oct 23, 2004 at 10:28:25AM +0200, Niklas wrote: Similar issue here.. /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Wayne McDougall Sent: den 23 oktober 2004 08:59 To: [EMAIL PROTECTED] Subject: [freenet-support] 5098 Errors sendingPacket == null! Running 5098 on Windows XP SP2 768 Mb RAM More information available on request. The node is non-responsive. From Recent Logs 19:47:04 jobDone(160,true) on [EMAIL PROTECTED] but sendingPacket == null!- 19:48:52 resetting - 19:48:52 jobDone(160,true) on [EMAIL PROTECTED] but sendingPacket == null!- 19:48:57 Failed to send packet, no more conns, No open connections and no way to contact node: DISCARDING [EMAIL PROTECTED]@[EMAIL PROTECTED] (null,null): outbound attempts=0:0/0:freenet.Message: beee48: DataChunk @a3c1cfa4a430cdae:null:[EMAIL PROTECTED]:tru e, prio=1, expiryTime=1098514437842(-30 ms ago) on [EMAIL PROTECTED] (null,null): outbound attempts=0:0/0 - 19:49:03 jobDone(160,true) on [EMAIL PROTECTED] but sendingPacket == null!- 19:49:18 Consecutive same winner: [EMAIL PROTECTED]: timeToSendWindow=0, [EMAIL PROTECTED] (DSA(296b 4c9c 8e19 ef59 f21c c003 36a6 3027 3b86 d9c2),tcp/romper.dyndns.org:26243, sessions=1, presentations=3, ID=DSA(296b 4c9c 8e19 ef59 f21c c003 36a6 3027 3b86 d9c2), version=Fred,0.5,STABLE-1.51,5098): outbound attempts=1:0/1 on [EMAIL PROTECTED]: id=7668f1c687d0a1f9, expiresAt=1098514218352 (59570 ms), [EMAIL PROTECTED] DataRequest @null @ 7668f1c687d0a1f9, [EMAIL PROTECTED]@7668f1c687d0a1f9,t rue@ -1:1098514158352:false:null:[EMAIL PROTECTED] DataRequest @null @ 7668f1c687d0a1f9, sendTimeout=17720, [EMAIL PROTECTED] (ea8568751ef624ead2e446baf8ce0a95852586580f0203,request), EstimateList=freenet.node.rt.ForgettingEstimateList: length=106, at=0, noConnCount=0, backedOffCount=4 4 times - 19:49:18 Consecutive same winner: [EMAIL PROTECTED]: timeToSendWindow=0, [EMAIL PROTECTED] (DSA(296b 4c9c 8e19 ef59 f21c c003 36a6 3027 3b86 d9c2),tcp/romper.dyndns.org:26243, sessions=1, presentations=3, ID=DSA(296b 4c9c 8e19 ef59 f21c c003 36a6 3027 3b86 d9c2), version=Fred,0.5,STABLE-1.51,5098): outbound attempts=1:0/1 on [EMAIL PROTECTED]: id=7668f1c687d0a1f9, expiresAt=1098514218352 (59570 ms), [EMAIL PROTECTED] DataRequest @null @ 7668f1c687d0a1f9, [EMAIL PROTECTED]@7668f1c687d0a1f9,t rue@ -1:1098514158352:false:null:[EMAIL PROTECTED] DataRequest @null @ 7668f1c687d0a1f9, sendTimeout=17720, [EMAIL PROTECTED] (ea8568751ef624ead2e446baf8ce0a95852586580f0203,request), EstimateList=freenet.node.rt.ForgettingEstimateList: length=106, at=0, noConnCount=0, backedOffCount=5 5 times Continues on like this The node itself has effectively stopped functioning. ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] -- Matthew J Toseland - [EMAIL PROTECTED] Freenet Project Official Codemonkey - http://freenetproject.org/ ICTHUS - Nothing is impossible. Our Boss says so. ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] Re: 5098 Errors sendingPacket == null!
Here is yet a new message from the log, quite common.. seems to come in bursts: Did not terminate [EMAIL PROTECTED] (f6dd7956f46d3d344f81ba78e5edee7a628ac54d120302,insert), EstimateList=freenet.node.rt.ForgettingEstimateList: length=199, at=0, noConnCount=0, backedOffCount=0 /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Wayne McDougall Sent: den 24 oktober 2004 23:44 To: [EMAIL PROTECTED] Subject: [freenet-support] Re: 5098 Errors sendingPacket == null! Niklas Bergh [EMAIL PROTECTED] writes: Actually, it seems to have started getting better now.. I haven't seen any of those messages for a while in the log. No better for me. Last one in the log was less than 2 hours ago. 9:01:13 AM (freenet.MuxConnectionHandler, Network writing thread, ERROR): jobDone(160,true) on [EMAIL PROTECTED] but sendingPacket == null! Consecutive same winner errors are now everywhere: 10:31:43Consecutive same winner: [EMAIL PROTECTED]: timeToSendWindow=0, [EMAIL PROTECTED] (DSA(7f3a 5eec db54 57ee a534 8715 0928 d369 bf47 a9d0),tcp/iakin.poweruser.org:26828, sessions=1, presentations=3, ID=DSA(7f3a 5eec db54 57ee a534 8715 0928 d369 bf47 a9d0), version=Fred,0.5,STABLE-1.51,5098): outbound attempts=5:0/5 on [EMAIL PROTECTED]: id=65a8258c50575a40, expiresAt=1098653506249 (2379 ms), [EMAIL PROTECTED] DataRequest @null @ 65a8258c50575a40, [EMAIL PROTECTED]@65a8258c50575a40, [EMAIL PROTECTED]:1098653503249:false:null:[EMAIL PROTECTED] DataRequest @null @ 65a8258c50575a40, sendTimeout=17720, [EMAIL PROTECTED] (601d992fd890b89d4bdb0f5ff5d84018c231a5440f0203,request), EstimateList=freenet.node.rt.ForgettingEstimateList: length=76, at=0, noConnCount=0, backedOffCount=11 11 times ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] is there any documentation
Well, the load section in the general information page really is the best documenation of how the load factor is calculated. The load section of the general information page explains, both the formula for how the load is calculated, as well as what values that your node currently puts on the different factors that are included in the formula. /N On Sun, September 12, 2004 23:47, UltraRed said: that explains what the load status means on the freenet web interface? also, who do i interpret the other data under load on the general information page as well as the other pages? thanks. UltraRed___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] freenet.conf empty
Try running the freenet jar with a '--config' parameter. This should allow you to create a new freenet.conf file. On Mon, September 13, 2004 1:20, daniele said: Hi! I installed java, and run sh start-freenet.sh. I can use the interface, and i can also browse something. BUT, my freenet.conf file contains only 2 lines, and no conf questions where asked when at start-up. I remember I had the same problem when some months ago I tryed to install freenet, but I don't remember the solution Anyway, the output: localhost:/hdb/.freenet# sh start-freenet.sh Detected freenet-ext.jar Detected freenet.jar Sun java detected. Sun Java 1.4.2 detected. Starting Freenet now: Command line: java -Xmx128m -XX:MaxDirectMemorySize=128m freenet.node.Main Done localhost:/hdb/.freenet# INFO: Native CPUID library 'freenet/support/CPUInformation/libjcpuid-x86-linux.so' loaded from resource INFO: Optimized native BigInteger library 'net/i2p/util/libjbigi-linux-pentium3.so' loaded from resource ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] Is this a problem?
Believe me.. I have tried. The probable cause is that something somewhere forgets to close a file it is holding... I haven't managed to find out eactly what code it is though. /N Hmm. Since they don't happen on windows, they don't get debugged.. Unless you want to have a crack at them Iakin? On Sun, Aug 29, 2004 at 02:01:56PM +0200, Niklas Bergh wrote: Yes probably.. But they have been around forever, at least for windows users? /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] Is this a problem?
Yes probably.. But they have been around forever, at least for windows users? /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Plonk Sent: den 27 augusti 2004 22:57 To: [EMAIL PROTECTED] Subject: [freenet-support] Is this a problem? I get lots of these in my log: Delete failed on bucket t356f9930 Is this something I should be worried about? ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.su pport Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] Virus found in Freenet Update
Says downloader.OG is Windows-specific. This suggests it can't possibly have infected a JAR file. Okay, WHICH FILE did it report was infected? [12:16] osh I'm still curious about this downloader-og that my antivirus claims that nodeconfig.exe contains. Is my AV fscked up or is something else a bit fishy? cheers /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] OS X Problems
What about the logs? /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Noah Silverman Sent: den 24 augusti 2004 07:49 To: [EMAIL PROTECTED] Subject: Re: [freenet-support] OS X Problems Only in the browser window. The terminal session where I start freenet seems fine. Below is a typical start... sh start-freenet.sh Detected freenet-ext.jar Detected freenet.jar Sun java detected. Sun Java 1.4.2 detected. Starting Freenet now: Command line: java -Xmx128m freenet.node.Main Done G4-17:~/Desktop/freenet noah$ INFO: Native CPUID library jcpuid not loaded, reason: 'Dont know jcpuid library name for os type 'Mac OS X'' - will not be able to read CPU information using CPUID INFO: Native BigInteger library jbigi not loaded, reason: 'Dont know jbigi library name for os type 'Mac OS X'' - using pure java Niklas Bergh wrote: - Original Message - From: Noah Silverman [EMAIL PROTECTED] To: [EMAIL PROTECTED] Sent: Tuesday, August 24, 2004 4:22 AM Subject: [freenet-support] OS X Problems Hi, I was able to download the latest package. For some reason, it won't run unless I comment out the line about: JAVA_ARGS=-XX:MaxDirectMemorySize=128m $JAVA_ARGS Once that is done, I can start freenet. Do you get any type of error message? /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.su pport Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] OS X Problems
- Original Message - From: Noah Silverman [EMAIL PROTECTED] To: [EMAIL PROTECTED] Sent: Tuesday, August 24, 2004 4:22 AM Subject: [freenet-support] OS X Problems Hi, I was able to download the latest package. For some reason, it won't run unless I comment out the line about: JAVA_ARGS=-XX:MaxDirectMemorySize=128m $JAVA_ARGS Once that is done, I can start freenet. Do you get any type of error message? /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] Re: Freenet causing crashes...
-Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Mika Hirvonen Sent: den 18 augusti 2004 15:01 To: [EMAIL PROTECTED] Subject: [freenet-support] Re: Freenet causing crashes... Don Gregory writes: I just recently setup a node, and I'm trying to let it run for a while to give it a chance to spread its tendrils so to speak. I'm at the point now where it's had maybe 4-5 hours to run over my 3Mb cable connection and I'm STARTING to get a little responsiveness from the network. Problem is, I want to leave it running for several hours to fully propagate itself, whatever, but it seems to be gobbling up a LOT of CPU power. Well, not the Freenet executable, but the java engine running The freenet.exe is just the system tray application, not Freenet itself. it. That by itself wouldn't be a problem, but it seems to be making my computer crash. After leaving it running for 15 minutes or so, my computer will spontaneously crash/shut-down. Sounds like that your CPU is overheating. I tried setting the CPU priority in the config tool to be below normal, I tried setting the process priority in Task Manager to be below normal for both the javaw.exe and freenet.exe processes, but it's still devouring over 90% of my CPU on average, and it's still crashing my Programs with low priorities still can consume most of the CPU time, if there are no other CPU-intensive programs running. Also try setting the JavaMem parameter in the FLaunch.ini file to something like '192M' or '256M' instead of whatever it is set to right now. Cheers /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] Re: My 5091 is dead (after 7 hours)
Do you have a log message stating something like 'No addresses found!' before those messages? Also try setting: logLevelDetail=freenet.node.IPAddressDetector:debug in the conf/ini file (dont forget to remove the leading %-sign if you use the one already in there) Then tell me what the log says right before the first of those NullPointerExceptions. cheers /N - Original Message - From: Sam [EMAIL PROTECTED] To: [EMAIL PROTECTED] Sent: Thursday, August 12, 2004 6:35 AM Subject: [freenet-support] Re: My 5091 is dead (after 7 hours) Niklas Bergh [EMAIL PROTECTED] writes: Any error messages in the log? I recommend that you upgrade your node to a v5091.. Which solves an issue wrt merging a new seednodes file (reseeding). Cheers /N When I try to reply to Niklas' post, Gmane tells me I'm top posting. So I'll write down here. I installed 5091, still no connections, no action, no nada. Exited and restarted freenet. Freenet.log shows null pointer exceptions: INFO: Native CPUID library 'freenet/support/CPUInformation/jcpuid-x86-windows.dll' loaded from resource INFO: Optimized native BigInteger library 'net/i2p/util/jbigi-windows-pentium4.dll' loaded from resource Aug 11, 2004 10:01:36 PM (freenet.node.states.maintenance.Checkpoint, YThread-4, ERROR): unhandled throwable in Checkpoint: Autodetection of IP addresses: java.lang.NullPointerException java.lang.NullPointerException at freenet.node.IPAddressDetector.checkpoint (IPAddressDetector.java:171) at freenet.node.IPAddressDetector.checkpoint freenet.node.states.maintenance.Checkpoint.checkpoint(Checkpoint.java:54) at freenet.node.states.maintenance.Checkpoint.received (Checkpoint.java:47) at freenet.node.StateChain.received(StateChain.java:177) at freenet.node.StateChain.received(StateChain.java:61) at freenet.node.StateChainManagingMessageHandler$ChainContainer.run (StateChainManagingMessageHandler.java:332) at freenet.node.StateChainManagingMessageHandler$ChainContainer. received (StateChainManagingMessageHandler.java:285) at freenet.node.StateChainManagingMessageHandler$ChainContainer.access$100 (StateChainManagingMessageHandler.java:204) at freenet.node.StateChainManagingMessageHandler.handle (StateChainManagingMessageHandler.java:96) at freenet.Ticker$Event.run(Ticker.java:323) at freenet.thread.YThreadFactory$YThread.run(YThreadFactory.java:285) Aug 11, 2004 10:09:27 PM (freenet.node.states.maintenance. Checkpoint, YThread-4, ERROR): unhandled throwable in Checkpoint: Autodetection of IP addresses: java.lang.NullPointerException java.lang.NullPointerException at freenet.node.IPAddressDetector.checkpoint (IPAddressDetector.java:171) at freenet.node.IPAddressDetector.checkpoint freenet.node.states.maintenance.Checkpoint.checkpoint (Checkpoint.java:54) at freenet.node.states.maintenance.Checkpoint.received (Checkpoint.java:47) at freenet.node.StateChain.received(StateChain.java:177) at freenet.node.StateChain.received(StateChain.java:61) at freenet.node.StateChainManagingMessageHandler$ChainContainer.run (StateChainManagingMessageHandler.java:332) at freenet.node.StateChainManagingMessageHandler$ChainContainer.received (StateChainManagingMessageHandler.java:285) at freenet.node.StateChainManagingMessageHandler$ChainContainer.access$100 (StateChainManagingMessageHandler.java:204) at freenet.node.StateChainManagingMessageHandler.handle (StateChainManagingMessageHandler.java:96) at freenet.Ticker$Event.run(Ticker.java:323) at freenet.thread.YThreadFactory$YThread.run (YThreadFactory.java:285) Aug 11, 2004 10:58:38 PM (freenet.node.states.maintenance.Checkpoint, YThread-0, ERROR): unhandled throwable in Checkpoint: Autodetection of IP addresses: java.lang.NullPointerException java.lang.NullPointerException at freenet.node.IPAddressDetector.checkpoint(IPAddressDetector.java:171) at freenet.node.IPAddressDetector.checkpoint(IPAddressDetector.java:87) at freenet.node.states.maintenance.Checkpoint.checkpoint (Checkpoint.java:54) at freenet.node.states.maintenance.Checkpoint.received (Checkpoint.java:47) at freenet.node.StateChain.received(StateChain.java:177) at freenet.node.StateChain.received(StateChain.java:61) at freenet.node.StateChainManagingMessageHandler$ChainContainer.run (StateChainManagingMessageHandler.java:332) at freenet.node.StateChainManagingMessageHandler$ChainContainer.received (StateChainManagingMessageHandler.java:285) at freenet.node.StateChainManagingMessageHandler$ChainContainer.access$100 (StateChainManagingMessageHandler.java:204) at freenet.node.StateChainManagingMessageHandler.handle (StateChainManagingMessageHandler.java:96) at freenet.Ticker$Event.run(Ticker.java:323) at freenet.thread.YThreadFactory$YThread.run(YThreadFactory.java:285) Any help would be appreciated. Sam ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] My 5091 is dead (after 7 hours)
Any error messages in the log? I recommend that you upgrade your node to a v5091.. Which solves an issue wrt merging a new seednodes file (reseeding). Cheers /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Sam Sent: den 11 augusti 2004 13:37 To: [EMAIL PROTECTED] Subject: [freenet-support] My 5091 is dead (after 7 hours) (I'm not complaining. I'm just providing info in case anyone wants it.) Windows XP Home 1.8 GHz 384 MB RAM Installed Build 5090 from Start menu, including new seednodes file. Load was 5-10% at first. Frost and Spider have been running for 6 hours. Now 7 hours later load is stable at 1%. Memory usage (pages/second, disk queue length) is low. Open Connections: Connections open (Inbound/Outbound/Limit) 0 (0/0/132) Transfers active (Transmitting/Receiving) 0 (0/0) Data waiting to be transferredNone Total amount of data transferred None Number of requests (sent/received)0/0 Node Status Info: Uptime: 0 days, 7 hours, 9 minutes Current routingTime: 0ms. Pooled threads running jobs: 2 (1.1%) Pooled threads which are idle: 25 Current estimated load for rate limiting: 10%. Load due to thread limit = 1.1% Load due to routingTime = 10% = 100ms / 1000ms = overloadLow (100%) Load due to messageSendTimeRequest = 20% = 100ms / 500ms = overloadLow (100%) Load due to output bandwidth limiting = 0% because outputBytes(0) = limit (5419007.856 ) = outLimitCutoff (0.9) * outputBandwidthLimit (100352) * 60 Load due to expected inbound transfers: 0% because: 3600.0 req/hr * 9.991E-5 (pTransfer) * 293454.0 bytes = 105643 bytes/hr expected from current requests, but maxInputBytes/minute = 15912960 (set input limit) * 60 * 1.1 = 1050255360 bytes/hr target Current estimated load for QueryRejecting: 1.1%. Routing Table (at /nodestatus.html) Number of known routing nodes 263 Number of node references 263 Number of newbie nodes0 Number of uncontactable nodes 263 Contacted and attempted to contact node references0 Contacted node references 0 Contacted newbie node references 0 Connections with Successful Transfers 0 Backed off nodes 0 Connection Attempts 0 Successful Connections0 Lowest max estimated search time 0ms Lowest max estimated DNF time 0ms Lowest global search time estimate30.0ms Highest global search time estimate 30.0ms Lowest global transfer rate estimate 0 bytes/second Highest global transfer rate estimate 0 bytes/second Lowest one hop probability of DNF 0.95 Highest one hop probability of DNF0.95 Lowest one hop probability of transfer failure0.95 Highest one hop probability of transfer failure 0.95 Single hop probability of QueryRejected 0.9 Single hop average time for QueryRejected 17720.0 Single hop probability of early timeout 0.9 Single hop average time for early timeout 17720.0 Single hop probability of search timeout 0.9 Single hop average time for search timeout493544.0 Single hop overall probability of DNF given no timeout0.9 Single hop overall probability of transfer failure given transfer 0.9 Probability of transfer given incoming request0.1 Total number of requests that didn't QR 0 Total number of reqests that timed out before a QR or Accepted 0 Implementationfreenet.node.rt.NGRoutingTable Freenet.log (62 KB in error logging mode) The first few errors: INFO: Native CPUID library 'freenet/support/CPUInformation/jcpuid-x86-windows.dll' loaded from resource INFO: Optimized native BigInteger library 'net/i2p/util/jbigi-windows-pentium4.dll' loaded from resource Aug 10, 2004 11:18:00 PM (freenet.client.http.FproxyServlet, YThread-30, ERROR): Unexpected Exception in FproxyServlet.doGet -- freenet.KeyException: Byte array does not contain a SVK freenet.KeyException: Byte array does not contain a SVK at freenet.keys.SVK.init(SVK.java:41) at freenet.keys.SVK.init(SVK.java:50) at freenet.client.ClientSVK.init(ClientSVK.java:53) at freenet.client.ClientSSK.init(ClientSSK.java:57) at freenet.client.ClientSSK.createFromRequestURI(ClientSSK.java:44) at sun.reflect.GeneratedMethodAccessor2.invoke(Unknown Source) at sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source) at java.lang.reflect.Method.invoke(Unknown Source) at freenet.client.AbstractClientKey.createClientKey (AbstractClientKey.java:49) at freenet.client.AbstractClientKey.createFromRequestURI (AbstractClientKey.java:36) at freenet.client.http.FproxyServlet.doGet(FproxyServlet.java:570) at javax.servlet.http.HttpServlet.service(Unknown Source) at javax.servlet.http.HttpServlet.service(Unknown Source) at
Re: [freenet-support] 5088 - New Build 5089 Doesn't Show On FProxy MainPage
Nodes tells each other their respective version.. When enough nodes of a newer version has appeared on the network your node will indicate that there is a new build available. /N -- Original Message -- From: [EMAIL PROTECTED] Reply-To: [EMAIL PROTECTED] Date: Thu, 05 Aug 2004 08:29:10 -0700 Since the 5089 announcement, I've been checking the FProxy main page for an indication that 5089 is available, but it doesn't show that it is available. I have been able to upgrade to 5089, but I'm concerned that there are nodes out there that won't know that it's time to upgrade. How is the FProxy main page made aware up a new version? ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] Re: FIX: Freenet thrashing the disk
I think default is 64 megs in the latest Sun JVMs /N - Original Message - From: Jano [EMAIL PROTECTED] To: [EMAIL PROTECTED] Sent: Thursday, August 05, 2004 1:21 PM Subject: [freenet-support] Re: FIX: Freenet thrashing the disk [EMAIL PROTECTED] wrote: woah, that's weird. afaicr, default==192 I thought it was 128... Since 5088 my Windows XP has been thrashing the disk like nothing I'd ever seen before. Memory load was high (440 Mb virtual on a 192 MB physical machine) but not extremely unusual. According to Task Manager Java and Freenet weren't taking large amountas of memory. I put it down to being associated with general network issues. But with 5089 it was still a problem. My computer was virtually unusable and I don't think my node was performign well. I wasn't getting any error messages about out of memory (although periodically Windows would advise that my Virtual memory was too low and increase it). The node was working, but like the whole computer was very slow, and the disk was going all the time. THE SOLUTION: In the file flaunch.ini (located in \program files\freenet ) I changed the line JavaMem=default to become: JavaMem=192 Rebooted and restarted Freenet and now my node is working the best I've ever seen and the disk thrashing has stopped. I don't know if 192 is a good choice. I don't know why default became bad - too many node references? Crassoing some threshold? I did increase by datastore size a week earlier...or was it the BigInteger(?) optimisations introduced in 5088? I'm posting this in case anyone else finds it useful, and also so that if someone has a chance to think about what default means in flaunch.ini it sure wasn't a good choice for me. ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] FYI: Build 5087 Error message
For gods sake, you are the _third_ person to report this. Read the other messages for a description of the cause. It is being worked on. This particular issue has nothing to do with the CPU usage though.. tail freenetERROR: The resource freenet/support/CPUInfo mation/libjcpuid-x86-linux.so was not a valid library for this platform java.lang.UnsatisfiedLinkError: /tmp/jcpuid15030lib.tmp: libgcc_s.so.1: cannot pen shared object file: No such file or directory at java.lang.ClassLoader$NativeLibrary.load(Native Method) at java.lang.ClassLoader.loadLibrary0(ClassLoader.java:1560) at java.lang.ClassLoader.loadLibrary(ClassLoader.java:1456) at java.lang.Runtime.load0(Runtime.java:737) at java.lang.System.load(System.java:811) at freenet.support.CPUInformation.CPUID.loadFromResource(CPUID.java:460 at freenet.support.CPUInformation.CPUID.loadNative(CPUID.java:392) at freenet.support.CPUInformation.CPUID.clinit(CPUID.java:32) at net.i2p.util.NativeBigInteger.resolveCPUType(NativeBigInteger.java:1 2) at net.i2p.util.NativeBigInteger.clinit(NativeBigInteger.java:113) at freenet.crypt.Util.clinit(Util.java:89) at freenet.crypt.Yarrow.accumulator_init(Yarrow.java:268) _ Get Paid to Surf the Web! http://www.alladvantage.com/home.asp? refid=AVZ855 ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.su pport Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] CPU pegging at 100% since 5085
Could you produce a full stackdump when the node is using 100% of the CPU Is the node close to the configured memory limit (-Xmx)when it is using 150MB? cheers /N - Original Message - From: Mike Z To: [EMAIL PROTECTED] Sent: Tuesday, July 27, 2004 2:57 AM Subject: [freenet-support] CPU pegging at 100% since 5085 Since upgrading to 5085 (and 5086), Freenet is using up a huge amount of processor time, to the point where the web interface no longer even responds. This doesn't happen every start, but once it occurs, freenet has to be killed and restarted. It sometimes happens when first started, sometimes after running for a while.The machine is running Win XP, with a 3.2Ghz P4 with HT, and 1GB of RAM. Both processor threads are pegged at full utilization, and freenet is holding steady at about 150MB of RAM used. Any help would be appreciated.Uptime: 0 days, 1 hour, 51 minutes Current routingTime: 0ms. Pooled threads running jobs: 272 (54.4%) [Rejecting incoming connections and requests!] Pooled threads which are idle: 10It's normal for the node to sometimes reject connections or requests for a limited period. If you're seeing rejections continuously the node is overloaded or something is wrong (i.e. a bug). Current estimated load for rate limiting: 452.2%. Load due to thread limit = 54.4%Load due to routingTime = 10% = 100ms / 1000ms = overloadLow (80%)Load due to messageSendTimeRequest = 452.2% = 4522ms / 1000ms overloadLow (80%)Load due to output bandwidth limiting = 14.6% because outputBytes(215153) = limit (1474560 ) = outLimitCutoff (2) * outputBandwidthLimit (12288) * 60Load due to expected inbound transfers: 2.4% because: 404.76961565213924 req/hr * 0.030716723549488085 (pTransfer) * 377327.0 bytes = 4691380 bytes/hr expected from current requests, but maxInputBytes/minute = 2949120 (output limit assumed smaller than input capacity) * 60 * 1.1 = 194641920 bytes/hr targetCurrent estimated load for QueryRejecting: 55.4%. ___Support mailing list[EMAIL PROTECTED]http://news.gmane.org/gmane.network.freenet.supportUnsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/supportOr mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] Connection bug in recent builds
Hmm..I am not so sure about that.. I am also seeing _load_ of those messages recently. If there is a crypto error then the link will probably be corrupted, right? So.. the peer cannot for sure know when it cannot expect more data to arrive.. But.. this is just a theory.. I haven't inspected the code for the truth. /N - Original Message - From: Marc [EMAIL PROTECTED] To: [EMAIL PROTECTED] Sent: Sunday, July 25, 2004 12:14 PM Subject: Re: [freenet-support] Connection bug in recent builds Hi toad, you wrote Recent builds, both stable and unstable, have a bug that causes connections to fail with crypto related errors. This is probably not due to NativeBigInteger, as it happens on stable, which doesn't have NBI. Iakin has produced it reliably, although most nodes seem to work anyway. It can be reliably reproduced on a local test network. I have made some progress (an identity appears to be corrupted somehow), but I haven't finished yet. I will fix it on Monday. Do these errors include the following? This doesn't look crypto related. 25.07.2004 11:40:14 (freenet.support.io.NIOInputStream, YThread-2822, NORMAL): waited more than 12ms in NIOIS.read() tcp/connection: 8481127.0.0.1:36693,[EMAIL PROTECTED]:freenet.support [EMAIL PROTECTED] closing java.lang.Exception: debug at freenet.support.io.NIOInputStream.read(NIOInputStream.java:302) at freenet.interfaces.FreenetConnectionRunner.handle(FreenetConnectionRunner.ja va:81) at freenet.interfaces.LocalNIOInterface$ConnectionShell.run(LocalNIOInterface.j ava:268) at freenet.thread.YThreadFactory$YThread.run(YThreadFactory.java:285) I used ethereal, but forgot to save. So from memory this is what happens: Frost sends a ClientHello message, but gets no answer and after 2 minutes, fred resets the connection. Adiaux Marc ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] NPEs and other exceptions with 5085
There is also a typo in MuxConnectionHandler.java: 'utbound' rather than 'outbound'. Fixed now :) /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] Load
-Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Zenon Panoussis Sent: den 20 juli 2004 05:15 To: [EMAIL PROTECTED] Subject: Re: [freenet-support] Load I wrote: Taking what you say here for granted, the entire discussion up to this point is probably a meaningless exchange based on some misunderstanding on my part. But what? [URIs from logs] Would be interested to see some of this list. Duh. So am I by now, but with all the messing around today I deleted them. I can try again though. Now I know what the misunderstanding was. The working URIs I found in my logs come from the default bookmarks in the interface servlet. I had never visited them before, but they had passed my client anyway. Yes, the node tries to preload them when it starts. Cheers /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] What are distribution servlets used for?
Please check freenet.log for any error messages. /N - Original Message - From: Weiliang Zhang [EMAIL PROTECTED] To: [EMAIL PROTECTED] Sent: Sunday, July 11, 2004 3:00 PM Subject: Re: [freenet-support] What are distribution servlets used for? Florian Streck wrote: On Sun, Jul 11, 2004 at 01:30:57PM +0100, Weiliang Zhang wrote: Saw the port 8891 in freenet.conf only today What are distribution servlets used for? My nodes seems to be running ok with this port firewalled. As it seems it is used for the Distribution Pages (click on the link Spread Freenet in the Web-Interface). This spreads a freenet-zip with your personal seednodes. So not all people start with the same seednodes. This should make the net better connected I think. I have activated the distribution port and the allowHosts is the default, i.e. everyone. However, when I clicked Spread Freenet I got a blank page with only one line that says: Error. Any ideas? If the port is firewalled it just means your Distribution pages can't be accessed once they are created. It has nothing to do with the running of your node. Florian -- Best regards, Weiliang Zhang ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] Stable build 5083
Reseed it. 5083 sets 5082 to mandatory and if you haven't run your node for a while chance is that all the nodes in your old rt was older than 5082. /N - Original Message - From: Jonathan Towle [EMAIL PROTECTED] To: Freenet [EMAIL PROTECTED] Sent: Sunday, May 30, 2004 4:38 AM Subject: RE: [freenet-support] Stable build 5083 I hadn't started my rinky-dinky dialup transient node for a while, so I tried updating with 5083 and the latest seednodes. It correctly detects me as transient, but is unable to connect to any other nodes. I can see I'm sending syn packets to addresses, but I can't establish any connections. My setup: Win2K, 56K dialup, latest everything from Freenet. The log: May 29, 2004 10:17:21 PM (freenet.node.Main, main, NORMAL): Starting Freenet (Fred) 0.5 node, build #5083 on JVM Sun Microsystems Inc.:Java HotSpot(TM) Client VM:1.4.2-b28 May 29, 2004 10:17:23 PM (freenet.node.Main, main, NORMAL): loading node keys: node May 29, 2004 10:17:23 PM (freenet.node.Main, main, NORMAL): Read node file May 29, 2004 10:17:24 PM (freenet.node.Main, main, NORMAL): starting filesystem May 29, 2004 10:17:27 PM (freenet.node.Main, main, NORMAL): loading data store May 29, 2004 10:17:27 PM (freenet.node.Main, main, NORMAL): loading routing table May 29, 2004 10:17:27 PM (freenet.node.Main, main, NORMAL): From output: 49152.0 May 29, 2004 10:17:27 PM (freenet.node.Main, main, NORMAL): Setting default initTransferRate to 49152.0 May 29, 2004 10:17:27 PM (freenet.node.rt.NGRoutingTable, main, NORMAL): Loading estimators May 29, 2004 10:17:28 PM (freenet.node.Main, main, NORMAL): Created new NGRT May 29, 2004 10:17:28 PM (freenet.node.Main, main, NORMAL): Loaded stats May 29, 2004 10:17:28 PM (freenet.node.Main, main, NORMAL): loading temp bucket factory May 29, 2004 10:17:28 PM (freenet.node.Main, main, NORMAL): loaded temp bucket factory May 29, 2004 10:17:28 PM (freenet.node.Main, main, NORMAL): Loaded bucket factory May 29, 2004 10:17:29 PM (freenet.node.Main, main, NORMAL): read seed nodes May 29, 2004 10:17:29 PM (freenet.node.Main, main, NORMAL): Initial refs count: 5 May 29, 2004 10:17:29 PM (freenet.node.Main, main, NORMAL): not seeding routing table May 29, 2004 10:17:29 PM (freenet.node.Main, main, NORMAL): saved routing table May 29, 2004 10:17:29 PM (freenet.node.Main, main, NORMAL): starting node May 29, 2004 10:17:30 PM (freenet.node.Main, main, NORMAL): loading service: mainport May 29, 2004 10:17:31 PM (freenet.node.Main, main, NORMAL): loading service: distribution May 29, 2004 10:17:31 PM (freenet.interfaces.servlet.SingleHttpServletContainer, main, NORMAL): Loading the single servlet distribution.params.servlet May 29, 2004 10:17:31 PM (freenet.node.Node, main, NORMAL): Starting ticker.. May 29, 2004 10:17:31 PM (freenet.node.Node, main, NORMAL): Starting interfaces.. May 29, 2004 10:17:31 PM (freenet.node.http.BookmarkManagerServlet, main, NORMAL): Bookmarks updated on request May 29, 2004 10:17:32 PM (freenet.node.Node, main, NORMAL): starting ListenSelector.. May 29, 2004 10:17:32 PM (freenet.node.Main, main, NORMAL): Not announcing because I am transient. May 29, 2004 10:17:37 PM (freenet.node.Main$InsertARK, YThread-2, NORMAL): RouteNotFound Inserting ARK May 29, 2004 10:17:42 PM (freenet.node.Main$InsertARK, YThread-5, NORMAL): RouteNotFound Inserting ARK May 29, 2004 10:17:47 PM (freenet.node.Main$InsertARK, YThread-3, NORMAL): RouteNotFound Inserting ARK May 29, 2004 10:17:53 PM (freenet.node.Main$InsertARK, YThread-8, NORMAL): RouteNotFound Inserting ARK May 29, 2004 10:17:58 PM (freenet.node.Main$InsertARK, YThread-8, NORMAL): RouteNotFound Inserting ARK May 29, 2004 10:18:03 PM (freenet.node.Main$InsertARK, YThread-6, NORMAL): RouteNotFound Inserting ARK May 29, 2004 10:18:09 PM (freenet.node.Main$InsertARK, YThread-3, NORMAL): RouteNotFound Inserting ARK May 29, 2004 10:18:14 PM (freenet.node.Main$InsertARK, YThread-0, NORMAL): RouteNotFound Inserting ARK May 29, 2004 10:18:19 PM (freenet.node.Main$InsertARK, YThread-9, NORMAL): RouteNotFound Inserting ARK May 29, 2004 10:18:24 PM (freenet.node.Main$InsertARK, YThread-4, NORMAL): RouteNotFound Inserting ARK May 29, 2004 10:18:29 PM (freenet.node.Main$InsertARK, YThread-4, NORMAL): RouteNotFound Inserting ARK May 29, 2004 10:18:34 PM (freenet.node.Main$InsertARK, YThread-6, NORMAL): RouteNotFound Inserting ARK May 29, 2004 10:18:39 PM (freenet.node.Main$InsertARK, YThread-3, NORMAL): RouteNotFound Inserting ARK May 29, 2004 10:18:44 PM (freenet.node.Main$InsertARK, YThread-2, NORMAL): RouteNotFound Inserting ARK May 29, 2004 10:18:49 PM (freenet.node.Main$InsertARK, YThread-9, NORMAL): RouteNotFound Inserting ARK -vinyl1 ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at
RE: [freenet-support] Re: Java Applet
From the freenet.ini file: # A comma-separated list of hosts that may connect to the FCP port # (clientPort). If left blank, only the localhost will be allowed. If you set this, make sure localhost is included in the list or access won't be allowed from the local machine. # May be given as IP addresses or host names. %fcpHosts= -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of sally Sent: den 24 maj 2004 10:26 To: [EMAIL PROTECTED] Subject: [freenet-support] Re: Java Applet Roger Oksanen [EMAIL PROTECTED] writes: The only limitation when creating a java applet is the sanbox the applet is run in. By default the sanbox limits the applet from connecting other hosts than the applet source host (e.g. the applet server must be running a freenet node accepting FCP connections from other hosts). Is it possible for a node to accept FCP connections from other hosts? I've read that you can only use FCP for clients running on a machine hosting a node. I also read somewhere that there may be a crypto version of FCP coming out to allow connections from other hosts. Ideally, we want a Java Applet running on a machine without a node to be able to insert a file onto Freenet. Is this possible? Any pointers from you would be greatly appreciated. ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.su pport Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] Freenet directory sharing between Linux/windoz
Or adding code to handle the situation better even... /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Thomas Guyot-Sionnest Sent: den 19 maj 2004 05:57 To: [EMAIL PROTECTED] Subject: Re: [freenet-support] Freenet directory sharing between Linux/windoz TLD wrote: Roger Oksanen wrote: I'm guessing that freenet does a listing to decide if there exists a valid datastore. It would not be to efficient to open every file just Lame as it may sound, try disabling the index file for the datastore. Thank for the tip! I'll try in the next days... If it works maybe it's worth adding a FAQ entry... doesn't it? Thank again all for your help, I'll follow-up in a few days. Thomas Guyot ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.su pport Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] Re: Stable build 5082
How could that happen??? It is the same problem you had in the unstable branch, isn't it? So why did the modification, which have caused the problem in unstable, get into the code of the stable branch, before it was tested for a longer period (at least a day or two) in the unstable network? For what are you running the unstable network? I DO NOT UNDERSTAND IT! Hmmm.. Because noone noticed that the modification was buggy at the time when it was committed (read last summer) maybe? /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] 5078 (Stable) Just Sits There, Does Nothing
Get them either by spawning the node with the '--help' parameter or by having a look here: http://localhost:/servlet/nodeinfo/documentation/cli /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Nicholas Sturm Sent: den 13 maj 2004 08:46 To: [EMAIL PROTECTED] Subject: RE: [freenet-support] 5078 (Stable) Just Sits There, Does Nothing [Original Message] From: Niklas Bergh [EMAIL PROTECTED] To: [EMAIL PROTECTED] Date: 5/12/2004 3:12:29 PM Subject: RE: [freenet-support] 5078 (Stable) Just Sits There, Does Nothing Yes it has :) Where is the list in case I happen to want to use them? ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.su pport Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] 5078 (Stable) Just Sits There, Does Nothing
Hmmm.. Can it be so that you are using an unstable build (6xxx) along with stable-network seednodes (5xxx) or the other way around? /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of [EMAIL PROTECTED] Sent: den 12 maj 2004 17:02 To: [EMAIL PROTECTED] Subject: Re: [freenet-support] 5078 (Stable) Just Sits There, Does Nothing At 02:21 PM 5/12/2004 +0100, you wrote: Okay. Show me the header (the lines at the top, before the table) from http://127.0.0.1:/servlet/nodestatus/nodestatus.html If it says 0 node references, stop freenet, remove it, reinstall it with new seednodes, and if it still doesn't work, send me your freenet.log Number of known routing nodes 0 Number of node references 0 Number of newbie nodes0 Number of uncontactable nodes 0 Contacted and attempted to contact node references0 Contacted node references 0 Contacted newbie node references 0 Connections with Successful Transfers 0 Backed off nodes 0 Connection Attempts 0 Successful Connections0 Lowest max estimated search time 0ms Lowest max estimated DNF time 0ms ...etc... And still the same after reinstalling (via the update sanapshot feature) and re-downloading the seednodes.ref. ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.su pport Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] 5078 (Stable) Just Sits There, Does Nothing
Is it running? Has it any connections open? Does it say something bad in the log? /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of [EMAIL PROTECTED] Sent: den 11 maj 2004 06:12 To: [EMAIL PROTECTED] Subject: [freenet-support] 5078 (Stable) Just Sits There, Does Nothing Windows XP Pro After having Freenet disabled for a couple of weeks while I was doing some heavy downloading I decided to fire it up again. I figured it was a good idea to update the snapshot from 5077 first. Big mistake. Now it does nothing. All I did was update the snapshot and download the new seednodes.ref. I haven't changed anything else with my configuration. What could be going wrong? ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.su pport Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] I have block by Internet gateway!So I can not getthe lasted freenet version, can mail to me a windows version?
Title: Message Blocked from what? HTTP communication to www.frenetproject.org? If so.. then maybesomeone cancreate a distributionpage for you... /N -Original Message-From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of west boySent: den 6 maj 2004 03:46To: [EMAIL PROTECTED]Subject: [freenet-support] I have block by Internet gateway!So I can not getthe lasted freenet version, can mail to me a windows version? Do you Yahoo!?Win a $20,000 Career Makeover at Yahoo! HotJobs ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] TO big LOG!
gmane.org /N - Original Message - From: Edward Langenback [EMAIL PROTECTED] To: Cameron GArnham [EMAIL PROTECTED] Sent: Friday, April 30, 2004 10:13 PM Subject: Re: [freenet-support] TO big LOG! -BEGIN PGP SIGNED MESSAGE- Hash: SHA1 On Friday, April 30, 2004 at 8:34:08 AM in Message mid:[EMAIL PROTECTED], Cameron wrote: System: AMD 1.4gz ; 256MB RAM OS debian testing KERNEL 2.6.3 FREENET VER: 5077 JAVA: ava version 1.5.0-beta Java(TM) 2 Runtime Environment, Standard Edition (build 1.5.0-beta-b32c) Java HotSpot(TM) Client VM (build 1.5.0-beta-b32c, mixed mode) currently the log is 5.7GB there MUST be a cap!. I dnot know much about this Hope that this helps. I will be glad to help a proviede more info but the F/N dir gets deleted. unless i'm mistaken, I belive there are *nix scripts that handle rotating log files... I've seen 'em posted on here before... is there a list archive perhaps? in Him, -Ed - -- Note: If this email does not have a *VALID* PGP signature you should contact me to verify the content. PGP Key ID: 0xB9E76C70 - -=-=-=-=-=-=-=-=-=-=-= *Christ is NOT Jesus' last name!* - -=-=-=-=-=-=-=-=-=-=-= Psalm 23 And The Days Of Our Lives http://peculiar.wcw.net/days23.shtml / \ \ / Join the ASCII-Ribbon Campaign to Stamp Out HTML Email ! X / \ -BEGIN PGP SIGNATURE- Version: PGPsdk version 1.7.1 (C) 1997-1999 Network Associates, Inc. and its affiliated companies. iQA/AwUBQJKzV7cY6Vy552xwEQK7nQCg7E9Lm6kEXwnLU89s2Sot0NSRyCoAn2JW TtavL4iPfEuurqcT2yDPkndy =kGCD -END PGP SIGNATURE- ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] Freenet crashes DSL modem
You are not alone in this if would seem: http://www.dslreports.com/forum/remark,8777483~mode=flat Someone says: 'If you guys are still having problems with your Actiontec's. Call into the Qwest DSL repair center and have them escalate it to the Actiontec engineers. If that doesn't work, they will bring you a new GT 701 modem.' /N - Original Message - From: Galen [EMAIL PROTECTED] To: [EMAIL PROTECTED] Sent: Saturday, May 01, 2004 5:30 AM Subject: [freenet-support] Freenet crashes DSL modem Hi, I've got an interesting arrangement here. It appears that when I run freenet, it crashes the DSL/NAT (combo device) actiontec DSL modem. Yes, it totally freezes, no data in or out (no pings, dhcp, etc) until physically reset. The arrangement is somewhat unusual, but I can reliably crash the modem. Every single time. Here's how the network layout: Qwest DSL Modem Actiontec w/NAT connected to a Netgear wireless router's LAN side, which creates a wireless network. Then, near the boundary of reception, there's a D-Link access point in client mode that's connected to the netgear wireless network. The ethernet cable from the client mode AP connects to the WAN port on a d-link wireless router. I then connect a variety of computers to the d-link's wireless network. This provides two virtual network with the same internet connection, but different encryption options, coverage areas, etc - exactly my goal. Yes, this is very unusual (both the network and the behavior), and no, I don't want to spend much time trying to fix the problem, but if it's something that there's an easy fix to, I'm all for that, otherwise, it's just another entry for the quirky things list. -Galen ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] Mac
Someone answered this question the day before yesterday.. Check here: http://article.gmane.org/gmane.network.freenet.support/4034 /N - Original Message - From: Keith [EMAIL PROTECTED] To: [EMAIL PROTECTED] Sent: Thursday, April 29, 2004 9:48 PM Subject: [freenet-support] Mac How do I install and get running freenet on Mac OSX.3 ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] various problems
-Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of [EMAIL PROTECTED] Sent: den 26 april 2004 19:34 To: [EMAIL PROTECTED] Subject: [freenet-support] various problems I wanted to report, that I get currently a lot of the following error messages: Action cannot be taken after termination Additional logging has been added to unstable to help tracking down this issue. java.lang.Exception: debug Please close() me manually in finalizer: Key: *removed* Buffer: [EMAIL PROTECTED] * : *removed*:temp:*removed* New: true ( 0 of 262460 read) java.lang.IllegalStateException: unclosed Hmm.. That is an only issue :( I do not know, what the error messages mean, but perhaps it has something to do with the following behaviour: Every time I insert something, the value Space used by temp files increases irreversible. Does it increase _only_ when you insert or will it increase no matter what? It does not matter if the insert succeeds or not (usually not, my current insert speed is between 0kb/s and 1kb/s, sometimes freenet does not manage to get anything inserted for hours), the value increases and never decreases again. The crazy thing about this is, that the temp folder contains at any time only some files (the maximum I observed was something around 20). At one time there was not one single file in the temp folderand freenet reported 200MB of temp files... There seems to be a whole bunch of different temp files around.. Not only 'store\temp'... Maybe some of those other contained files? This behaviour ends normally in a Java VM crash after some time What do you mean with crash? (I do not think, that the crashes have something to do with this, Java VM crashes occured already before, but just in case...), or, if the reported temp file value reaches around 700MB, in a IO error, because too many files are opened. (Which files?! Some files in the datastore?) Can you check with the OS which files that are open? I am not a linux guy but isn't there a command like lsof or something that can do this? Freenet is already working with the same settings for months, so I do not think, that I have misconfigured anything, but it may be, that I just had not inserted enough in the past, to notice this behaviour. (The node is running on Linux Mandrake 9.1, so this is definatly not the windows temp file bug or something like that!) A month ago I did not insert much data and I could run freenet for up to 2 days or more on that computer without any crash Again, what do your mean by crash? (as long as I did not put heavy load on the node), so this should have something to do with recent changes, but I could be wrong there. I have already tried various changes to the settings (for example disabling the diagnostics, just in case that they use temp files or disabling the datastore index, Don't worry.. _that_ they won't do :) ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] Automatic server retry of failing documents
-Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Ole Tange Sent: den 26 april 2004 19:35 To: [EMAIL PROTECTED] Subject: [freenet-support] Automatic server retry of failing documents Quite a few of the documents that I try to get from freenet are not immediately available. Usually I will have to retry a few times every day and then suddenly the document is there. The document can be a file in itself or a part of a multipart download. Now I believe I can live with freenet being slow and that many documents are not immediately available. What is annoying me is that _I_ will have to do the retrying. Why is that not a task for the server? You sure? I thought we had a meta-refresh tag on those RNF/DNF pages? Wont the browser automatically retry the page after a while if you leave it to? /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] Re: Question re: accessing my Freenet node fromanother computer
-Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of MonkeyOmen Sent: den 22 april 2004 04:15 To: [EMAIL PROTECTED] Subject: [freenet-support] Re: Question re: accessing my Freenet node fromanother computer Niklas Bergh [EMAIL PROTECTED] writes: Hmmm.. That ought to do it.. If you spawn a standard apache on the linux machine, can your 10.* machines access pages from it successfully? Yes. If not, then I think this is a TCP/IP routing issue... Do the test and we'll talk more it this is the issue. If they can.. Then I suggest that you crank up the loglevel on your freenet server and track what really happens when your 10.* machines tries to request something from http://192.168.1.10:/ I tried this but couldn't make any sense out of the *enormous* logfile generated. With logLevel set to Error nothing came up. With it set to Debug, it's 100,000+ lines in a short time. Can you tell me what should I search for in the logfile? Not straight ahead.. But you could try scanning the log file for the address of the machine that is unable to connect you your freenet server to see if there is anything obvious around there.. /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] NPE in build 5077
It is a known issue.. best workaround would probably be to remove the key from the RSL:s maintenance-queue before actually closing it.. /N - Original Message - From: Marc [EMAIL PROTECTED] To: [EMAIL PROTECTED] Sent: Tuesday, April 27, 2004 3:04 PM Subject: [freenet-support] NPE in build 5077 Hi, I just started to get these in the shell: Caught java.lang.NullPointerException running maintenance queue java.lang.NullPointerException at freenet.ConnectionHandler.getBuf(ConnectionHandler.java:866) at freenet.transport.ReadSelectorLoop.beforeSelect(ReadSelectorLoop.java:140) at freenet.transport.AbstractSelectorLoop.loop(AbstractSelectorLoop.java:734) at freenet.transport.ReadSelectorLoop.run(ReadSelectorLoop.java:669) at java.lang.Thread.run(Thread.java:534) The log contains the same: 27.04.2004 14:56:37 (freenet.transport.ReadSelectorLoop, Network reading thread, ERROR): Caught java.lang.NullPointerException running maintenance queue java.lang.NullPointerException at freenet.ConnectionHandler.getBuf(ConnectionHandler.java:866) at freenet.transport.ReadSelectorLoop.beforeSelect(ReadSelectorLoop.java:140) at freenet.transport.AbstractSelectorLoop.loop(AbstractSelectorLoop.java:734) at freenet.transport.ReadSelectorLoop.run(ReadSelectorLoop.java:669) at java.lang.Thread.run(Thread.java:534) I guess it's a coincidence, but the came after I had a look at the environment node info page. System is Linux 2.4.25, Sun Java 1.4.2_04 server vm Saluton Marc ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] various problems
This behaviour ends normally in a Java VM crash after some time What do you mean with crash? Look at the attachment, I attached some of the error messages of the past months. They are called HotSpot Virtual Machine Error or something similiar Urk, yes.. those are really crashed.. Unfortunately this is nothing that we can do anything about.. it is a Sun-issue.. or a driver issue or a hardware issue or something like that.. per definition this kind of crash should be impossible to cause from a java application inside the JVM :( /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] Connecting to a non-transient freenet server in a dmz from a dhcp freenet client behind the firewall
-Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of [EMAIL PROTECTED] Sent: den 21 april 2004 07:58 To: [EMAIL PROTECTED]; [EMAIL PROTECTED] Subject: [freenet-support] Connecting to a non-transient freenet server in a dmz from a dhcp freenet client behind the firewall Hello, I have a linux server that I want to run freenet on as a non-transient server hanging off a dsl line. I'd like to use the windows freenet client on a dhcp client as a transient Windows freenet client? Are you talking about FUQID? client so that it only goes to the linux freenet server. If you tell the client to talk to that server it will talk to that server only :) More on that below. E.g. a freenet proxy server if you will. Hmmm.. I don't really understand that statement.. The freenet server/node is a freenet server/node and the machine running FIW or Frost or FUQID or whatever is a client to that server/node... Would anyone have any idea how to configure either or both serers to that end. The freenet server/node has to be told to accept FCP connections from the client machine. Check the 'fcpHosts' param in the config file, it accepts both host addresses (e.g. 127.0.0.1, 192.168.0.1 etc) and network addresses (192.168.1.0/24 etc). Then the client application (FUQID or whatever) needs to be told to talk to the freenet server. Check the documentation for the application for information on how to do this. /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] Question re: accessing my Freenet node fromanother computer
I had no trouble getting the firewall to do the appropriate port forwarding to the server. Here's the problem. When I sit at my Linux server, fire up Mozilla, and go to http://127.0.0.1:/ or http://192.168.1.10:/ Freenet works just fine. When I sit at my laptop and try http://192.168.1.10:/ nothing happens. My freenet.conf file includes mainport.allowedHosts=* mainport.bindAddress=* which I thought would allow me to browse my Freenet node from another computer. What do I need to do to get this to work? Hmmm.. That ought to do it.. If you spawn a standard apache on the linux machine, can your 10.* machines access pages from it successfully? If not, then I think this is a TCP/IP routing issue... Do the test and we'll talk more it this is the issue. If they can.. Then I suggest that you crank up the loglevel on your freenet server and track what really happens when your 10.* machines tries to request something from http://192.168.1.10:/ Cheers /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] Unable to connect
Hmm.. Check in your freenet log file (probably 'c:\program files\freenet\freenet.log') if there is some kind of error message that might give you a hint (open the file using WordPad)... If it is not obvious from it what's causing the problem then send the log to the list and we'll work on from there... /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Henry Garcia Sent: den 17 april 2004 15:45 To: [EMAIL PROTECTED] Subject: [freenet-support] Unable to connect Downloaded Freenet. Icon is on desktop and systray. When I click to open, I get hourglass symbol for a few seconds then it stops. No connection is made to Freenet. I have a cable modem. Suggestions on possible prob preventing connection. Thanks! I'm quite the newbie to computers so minimum technical jargon would be appreciated. ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.su pport Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] 4 basics questions (transcient node / cache / fec/ version)
- Original Message - From: blured blured [EMAIL PROTECTED] To: [EMAIL PROTECTED] Sent: Sunday, April 18, 2004 2:16 AM Subject: [freenet-support] 4 basics questions (transcient node / cache / fec/ version) 1. How to make my node not transcient? I'm on linux with permanent connexion Either run it on a machine with a public IP-address or configure the public IP address in the configuration file while port-forwarding the listenPort to the node-running machine from the address-owning one (usually the firewall). 2. How to increase my cache of data ? Set the 'storeSize' parameter in the configuration file to a larger value 4. How do I know the latest version of freenet ? If there is a new version known this information is displayed in the node's web interface. Another good way of keeping up-to-date is to subscribe to this mailing list. New releases are announced here. /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] Newbie help WinXP cannot accesshttp://127.0.0.1:8888/
Below is the beginning of my log Apr 15, 2004 2:08:34 AM (freenet.node.Main, main, NORMAL): Starting Freenet (Fred) 0.5 node, build #5076 on JVM Sun Microsystems Inc.:Java HotSpot(TM) Client VM:1.4.0_01-ea-b02 It's a rather old JVM, you should try to upgrade to 1.4.2. As for the other messages, none of them looks critical, but if you get a lot of them, they might indicate a problem with the JVM.. It actually is so old that we _know_ there are bugs in it which prevents fred from working correctly :) /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] NAT Freenet
- Original Message - From: Galen [EMAIL PROTECTED] To: [EMAIL PROTECTED] Sent: Saturday, April 10, 2004 8:05 AM Subject: [freenet-support] NAT Freenet Hi, One of the places where I would like to use freenet is behind NAT. I know all about port mapping, but this simply isn't available in this situation. What is the hope of running Freenet? I know virtually every other protocol has implemented support for NAT as part of (or before) becoming mainstream... if this doesn't exist in freenet as of now, it might be something important if freenet were to ever become widely used. It is planned for.. not there yet though But.. due to the new BiDi facilities (in current unstable) my non-NATed node have started working suprisingly well.. /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] load average is too high
It took several minutes for the General page to come up. messageSendTimeRequest is 0, which probably doesn't tell you anything, so here's the page. Hmm. It's really struggling, even though it's not doing anything... I dunno what we can do about it... Produce a couple of full stackdumps to see where the threads are stuck? /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] Re: My freenet installation experiences
If I run as a full node (non-transient), would it 'hurt' the network that I am only connected a few hours a day on a slow connection? Well.. The slow part wont matter really but the 'few hours' part might.. Even though I have doannounce set to false, my log file is filled with request rejected, node is transient' messages. Is this normal? Well.. Possibly.. Might it be so that your node has announced at a previous time? ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] Route not found - stability next generationrouting
2) Even after having the node up for a wile and(!) successfully downloading content, the node more often fails to route the request to other nodes than before NG-routing. Wihtout NG routing I was able to have request returned with 25 HTL with a data not found error - a clear indication that the data was not there for sure. With NG routing I am having trouble to get a data-not found message at all, most of the errors I only get route not found with 1 or 2 nodes or even 0 being contacted. This is probably due to the recent Rate limiting facilites more than to NGRouting.. Ratelimiting will cause RNFs when your node overloads it neighbours with requests.. Now to my questions: a) is there a way to make my freenet node try to contact NEW nodes more often? For example by more aggressivle cleaning up the routing table? Well.. you could try increasing the size of the routing table maybe.. b) How can I tweak routing that my node (AFTER successfully receiving data!) does no longer think, it does no know where to deliver the requests to? c) Why does my node deliver route not found errors with onlny a few ( 5) other nodes it tried to contact? How can I make it contact more nodes? ( 20) This probably is partly due to a bug or two..however.. there might also be valid reasons for this behaviour..it is not impossible that your node doesn't _have_ any more nodes to contact (your node might have reached its request quota for all other nodes it knows about for instance etc.) d) Do nodes tell each other about the nodes they know? Yes.. information about other, new nodes are passed along within certain freenet messages. e) is it easy to get involved in the freenet development? Yes, quite easy.. however.. the code isn't eceptionally well documented.. /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] OutOfMemoryError
Fwolff said: And to the philosophy of some devs: RAM is cheap New SDRAM will be detected only with half of it's normal size or even not detected at all in old computers When I was having problems with half-size-detected issues it turned out that it was due to the old motherboard only managing to detect one _side_ of any double-sided SDRAMs... /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] Way to much RAM! Build 5064
I've repeatedly seen old machines like my P3-600 disregarded as irrelevant, and not worth optimizing for, in terms of the Freenet network. See above. The best thing I can do for you is get rate limiting working properly. And I think Freenet should easily run on a 600MHz machine, or something is wrong. I'm just skeptical about running on 128MB, or on 200MHz machines. I dont think it impossible to run a node on 128MB.. However.. if the OS uses up 80 of those we will definitely end up having problems. /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] routing table
It is noticeable that Freenet uses a ridiculous amount of RAM. If I run top on a node that connects to only one other node, and sporadically at that, I see that it is using 79 MB of memory. The number doesn't appear to grow -- there is no evidence of a memory leak -- but it starts out and remains huge. My single inactive node doesn't transmit any messages. The only thing that could account for the 79 MB of memory used would seem to be routing information relating to the 98 nodes it knows about: Please help out. Fire up a memory profiler of your choice at your machine and tell me what it is that occupies all that memory. When I do the same on my machine the node wont use more than 10-15 megs of memory. /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] routing table
Is it a VM bug or is it just creating objects it theoretically could reach (thus they don't get GC'd), but ignores forever? The second it what is defined as a 'memory leak' in GC'd environments. /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] routing table
Title: Message The routingtable filesare thertnodes_* and rtprops_* files in your choosenfreenet install folder. However.. these filesoccupies onlya few kilobytes of your harddrive. Is it HD space or RAM memory you want to free up? /N -Original Message-From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Robert GreenageSent: den 13 februari 2004 04:32To: [EMAIL PROTECTED]; [EMAIL PROTECTED]Subject: [freenet-support] routing table which folder in windows contains the routing table that needs to be deleted in order to free up memory? --- Robert Greenage --- [EMAIL PROTECTED] --- EarthLink: It's your Internet. ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] Probably a simply problem I'm having...
Yea... It kinda looks like you 'node' file is corrupt. Could you send it over to me (I want to see what is wrong with it) and then delete it and try restarting the node again? The 'node' file ought to be present in 'c:\program files\freenet'. /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Marcus Sent: den 13 februari 2004 11:36 To: [EMAIL PROTECTED] Subject: [freenet-support] Probably a simply problem I'm having... Hi all, Have had freenet up and running before I got a few (23) viruses on my PC (not through freenet). Got rid of them, reloaded windows, re-installed freenet and now can't get the Gateway to open. My little bunny icon isn't turning blue anymore!! Help!!! I know you guys have got some much more serious issues at the moment but any help would be much appreciated. Here is what the logfile says: 12-Feb-2004 00:00:04 (freenet.node.Main, main, NORMAL): Starting Freenet (Fred) 0.5 node, build #5068 on JVM Sun Microsystems Inc.:Java HotSpot(TM) Client VM:1.4.2_03-b02 12-Feb-2004 00:00:04 (freenet.node.Main, main, NORMAL): loading node keys: node 12-Feb-2004 00:00:04 (freenet.node.Main, main, ERROR): Unexpected Exception: java.io.EOFException java.io.EOFException at freenet.support.io.ReadInputStream.readUTFChar(ReadInputStream .java:223)at freenet.support.io.ReadInputStream.readToEOF(ReadInputStream.j ava:134) at freenet.support.io.CommentedReadInputStream.readToEOF(Commente dReadInputStre am.java:45) at freenet.support.io.ReadInputStream.readToEOF(ReadInputStream.j ava:184) at freenet.FieldSet.privParse(FieldSet.java:609) at freenet.FieldSet.parseFields(FieldSet.java:497) at freenet.FieldSet.parseFields(FieldSet.java:433) at freenet.FieldSet.init(FieldSet.java:88) at freenet.node.Main.loadNodeFile(Main.java:3408)at freenet.node.Main.main(Main.java:557) I am guess this has something to do with an Unexpected Exception whatever this means. Hope someone will make more sense of this than me. Many thanks, Marcus. ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.su pport Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] Probably a simply problem I'm having...
[EMAIL PROTECTED] It is named simply 'node', not 'node.file' but yes.. I think we might be talking about the same file. Yes, just delete it and restart the node (it ought to create a new file what that is done). /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Marcus Sent: den 13 februari 2004 13:36 To: [EMAIL PROTECTED] Subject: RE: [freenet-support] Probably a simply problem I'm having... Thank you so much Niklas, What is your e-mail address and it will be on it's way. Is that all I need to do, just delete it? Is it the 'node.file' mine is 1kb. Does this look right? Again many thanks, Marcus -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] Behalf Of Niklas Bergh Sent: 13 February 2004 10:43 To: [EMAIL PROTECTED] Subject: RE: [freenet-support] Probably a simply problem I'm having... Yea... It kinda looks like you 'node' file is corrupt. Could you send it over to me (I want to see what is wrong with it) and then delete it and try restarting the node again? The 'node' file ought to be present in 'c:\program files\freenet'. /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Marcus Sent: den 13 februari 2004 11:36 To: [EMAIL PROTECTED] Subject: [freenet-support] Probably a simply problem I'm having... Hi all, Have had freenet up and running before I got a few (23) viruses on my PC (not through freenet). Got rid of them, reloaded windows, re-installed freenet and now can't get the Gateway to open. My little bunny icon isn't turning blue anymore!! Help!!! I know you guys have got some much more serious issues at the moment but any help would be much appreciated. Here is what the logfile says: 12-Feb-2004 00:00:04 (freenet.node.Main, main, NORMAL): Starting Freenet (Fred) 0.5 node, build #5068 on JVM Sun Microsystems Inc.:Java HotSpot(TM) Client VM:1.4.2_03-b02 12-Feb-2004 00:00:04 (freenet.node.Main, main, NORMAL): loading node keys: node 12-Feb-2004 00:00:04 (freenet.node.Main, main, ERROR): Unexpected Exception: java.io.EOFException java.io.EOFExceptionat freenet.support.io.ReadInputStream.readUTFChar(ReadInputStream .java:223) at freenet.support.io.ReadInputStream.readToEOF(ReadInputStream.j ava:134)at freenet.support.io.CommentedReadInputStream.readToEOF(Commente dReadInputStre am.java:45) at freenet.support.io.ReadInputStream.readToEOF(ReadInputStream.j ava:184)at freenet.FieldSet.privParse(FieldSet.java:609) at freenet.FieldSet.parseFields(FieldSet.java:497) at freenet.FieldSet.parseFields(FieldSet.java:433) at freenet.FieldSet.init(FieldSet.java:88) at freenet.node.Main.loadNodeFile(Main.java:3408) at freenet.node.Main.main(Main.java:557) I am guess this has something to do with an Unexpected Exception whatever this means. Hope someone will make more sense of this than me. Many thanks, Marcus. ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.su pport Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.su pport Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.su pport Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] Crashes with 6469
-Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of [EMAIL PROTECTED] Sent: den 10 februari 2004 12:26 To: [EMAIL PROTECTED] Subject: [freenet-support] Crashes with 6469 After updating to 6469 I always get this log entry right after starting the node, before the first request is made. 12:13:07 Size was wrong reading in SimpleDataObjectStore This is prbably not causing you trouble.. I have committed some logging changes that will better say what the cause is now (will incluse a callstack and what the atual sizes are). Let me know what it says. Regards /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
Re: [freenet-support] Compiling freenet with gcj
Committed to unstable CVS. /N - Original Message - From: Ruben Garcia [EMAIL PROTECTED] To: [EMAIL PROTECTED] Sent: Wednesday, February 04, 2004 4:57 PM Subject: [freenet-support] Compiling freenet with gcj I found the problem. this patch should be applied to stable in order to be able to compile it with gcj. diff -ur alt.source/src/freenet/node/rt/DecayingKeyspaceEstimator.java source/src/freenet/node/rt/DecayingKeyspaceEstimator.java --- alt.source/src/freenet/node/rt/DecayingKeyspaceEstimator.java Tue Jan 13 06:02:08 2004 +++ source/src/freenet/node/rt/DecayingKeyspaceEstimator.java Wed Feb 4 16:49:05 2004 @@ -914,7 +914,7 @@ /* * @see freenet.node.rt.KeyspaceEstimator#getReport() */ - public HTMLReportTool getHTMLReportingTool() { + public KeyspaceEstimator.HTMLReportTool getHTMLReportingTool() { return new StandardHTMLReportTool(); } ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] Sun JRE 1.5.0 beta is a no go for Freenet
And here is the relevant documentation from sun: Keys may be removed from, but not directly added to, the selected-key set. Any attempt to add an object to the key set will cause an UnsupportedOperationException to be thrown. Someone: you could try to remove the call to fixKeys at AbstractSelectorLoop.java:692 Regards /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Someone Sent: den 5 februari 2004 16:28 To: [EMAIL PROTECTED] Subject: [freenet-support] Sun JRE 1.5.0 beta is a no go for Freenet Hi, just giving the new Sun JRE 1.5.0 beta a try. It promises about improved Performance made me hope that it could help me to run a stable node. But it doesn't work a bit at the moment. It just spams the error log (about 10 MB logdata per Minute) with the following: 05.02.2004 16:20:11 (freenet.transport.WriteSelectorLoop, write interface thread, ERROR): Caught throwable in AbstractSelectorLoop!: java.lang.UnsupportedOperationException java.lang.UnsupportedOperationException at sun.nio.ch.Util+1.add(Unknown Source) at freenet.transport.WriteSelectorLoop.fixKeys(WriteSelectorLoop. java:331) at freenet.transport.AbstractSelectorLoop.loop(AbstractSelectorLo op.java:692) at freenet.transport.WriteSelectorLoop.run(WriteSelectorLoop.java:747) at java.lang.Thread.run(Unknown Source) java.lang.UnsupportedOperationException at sun.nio.ch.Util+1.add(Unknown Source) at freenet.transport.WriteSelectorLoop.fixKeys(WriteSelectorLoop. java:331) at freenet.transport.AbstractSelectorLoop.loop(AbstractSelectorLo op.java:692) at freenet.transport.WriteSelectorLoop.run(WriteSelectorLoop.java:747) at java.lang.Thread.run(Unknown Source) java.lang.UnsupportedOperationException at sun.nio.ch.Util+1.add(Unknown Source) at freenet.transport.WriteSelectorLoop.fixKeys(WriteSelectorLoop. java:331) at freenet.transport.AbstractSelectorLoop.loop(AbstractSelectorLo op.java:692) at freenet.transport.WriteSelectorLoop.run(WriteSelectorLoop.java:747) at java.lang.Thread.run(Unknown Source) java.lang.UnsupportedOperationException at sun.nio.ch.Util+1.add(Unknown Source) at freenet.transport.WriteSelectorLoop.fixKeys(WriteSelectorLoop. java:331) at freenet.transport.AbstractSelectorLoop.loop(AbstractSelectorLo op.java:692) at freenet.transport.WriteSelectorLoop.run(WriteSelectorLoop.java:747) at java.lang.Thread.run(Unknown Source) java.lang.UnsupportedOperationException at sun.nio.ch.Util+1.add(Unknown Source) at freenet.transport.WriteSelectorLoop.fixKeys(WriteSelectorLoop. java:331) at freenet.transport.AbstractSelectorLoop.loop(AbstractSelectorLo op.java:692) at freenet.transport.WriteSelectorLoop.run(WriteSelectorLoop.java:747) at java.lang.Thread.run(Unknown Source) So it seems eighter fred is incompatible with the new JRE or it is due its beta state (although I never had such a Problem with the 1.4 betas before). Greets someone ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.su pport Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] Failed to send IdentifyPacketMessage Errors
It is an effect of a connection being closed quite immediately after it was opened. Could we move the enqueueing of the identify message a little while later? /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Nikita Proskourine Sent: den 4 februari 2004 01:04 To: [EMAIL PROTECTED] Subject: Re: [freenet-support] Failed to send IdentifyPacketMessage Errors I doubt this is new. I see these with older builds on my machine a lot as well. Nikita. Kevin Bennett wrote: Seeing hundreds of these today, roughly between 1 and 4 per second: 03-Feb-2004 21:39:35 (freenet.IdentifyPacketMessage, YThread-42, NORMAL): Failed to send IdentifyPacketMessage: freenet.SendFailedException: Against peer DSA(removed) @ removed - Sent 0 bytes (1551 of packet in notifyDone (nonterminal) freenet.SendFailedException: Against peer DSA(removed) @ removed - Sent 0 bytes (1551 of packet in notifyDone (nonterminal) at freenet.PeerPacket.jobDone(PeerPacket.java:180) at freenet.MuxConnectionHandler.terminate(MuxConnectionHandler.java:294) at freenet.PeerHandler.registerConnectionHandler(PeerHandler.java:650) at freenet.MuxConnectionHandler.setPeerHandler(MuxConnectionHand ler.java:152) at freenet.OpenConnectionManager.put(OpenConnectionManager.java:235) at freenet.MuxConnectionHandler.registerOCM(MuxConnectionHandler. java:501) at freenet.interfaces.FreenetConnectionRunner.handle(FreenetConn ectionRunner.ja va:141) at freenet.interfaces.PublicNIOInterface$ConnectionShell.run(Pub licNIOInterface .java:150) at freenet.thread.YThreadFactory$YThread.run(YThreadFactory.java:247) Does this mean anything, or is it just a glitch? I reseeded earlier on (the node wasn't transferring any data at all). Could reseeding have made this start happening? Kevin. ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.su pport Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] Way to much RAM! Build 5064
-Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of S Sent: den 28 januari 2004 13:57 To: [EMAIL PROTECTED] Subject: Re: [freenet-support] Way to much RAM! Build 5064 On Wed, 28 Jan 2004 13:33:42 +0100 Maximilian Mehnert [EMAIL PROTECTED] wrote: Freenet is one of the most beautiful ideas I ever hit on. But it should be possible to run it on a small pentium machine with no more than 100MB of RAM. I agree 100%. I have a machine dedicated to Freenet. It doesn't do anything else, period. It's a P3 600mhz with 192 megs of RAM. Both stable and unstable will max out its CPU most of the time. I suspect that the core issue is RAM, but I don't know for sure. Hmm.. Not necessarily I have loads of ram and a similar CPU and it is still maxed out :) /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] Route not found
Hmmm.. That page isn't the routing page.. It is the connections page.. The routing table can be viewed at http://localhost:/servlet/nodestatus/nodestatus.html But in principle you are correct. If a node is integrated into the network, not transient and able to receive inbound connections you ought to be able to see inbound connections within a day or two. regards /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Phillip Hutchings Sent: den 25 januari 2004 00:14 To: [EMAIL PROTECTED] Subject: Re: [freenet-support] Route not found Try today, freenet seems a bit healthier today. It currently seems to have a day down, then a day up. Weird. Looking at my routing table, it's pretty much the same, only outgoing. To me it seems like the routing table isn't growing - Freenet isn't discovering more nodes, which leads to the seed nodes being overloaded and dropping queries. My node is dropping queries 50% of the time when I use it as well. Maybe we need somewhere where people can drop their noderefs and others can get a random seednodes.ref file from that, rather than the static version at the moment. On 24/01/2004, at 10:12 AM, Peter T. Mayer wrote: After runnig freenet for at least 10 hours. My routingtable looks like the following: ... As you can see there are only outbound connections. Also I can not receive any pages. It worked for me until 3 months before. But then I made an update and now I can't use Freenet anymore. First I thougt there are some problems with the software, wich will be fixed in the next days, but today I realized that others can use freenet. I run Build: 5063 under linux. I have no firewall software installed and I don't have to use a proxy server. Has anyody an idea, why I have these problems? With kind regards, Peter T. Mayer PS: When I want to accesshttp://dodo.freenetproject.org/pipermail/support/from the support www page, I get an Error 403: You don't have permission to access /pipermail/support/ on this server. Archives are at http://news.gmane.org/gmane.network.freenet.support -- Phillip Hutchings [EMAIL PROTECTED] http://www.sitharus.com/ ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] number of connections
Well, If it works fine for you I think you should keep it. But.. Remember that for each connection that needs to be negotiated (the more ones allowed the less needs to be established), this increases you CPU load. Another issue is that fred requires you to allow for at least two connections per node in your rt.. If you have configured your node to allow only 20 connections your routing table will be reduces to only 10 nodes.. /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Steven Sent: den 25 januari 2004 08:21 To: [EMAIL PROTECTED] Subject: [freenet-support] number of connections since multiplexing has been ported to the stable branch of freenet, we can have a MUCH lower maxConnection setting right? I used allow 300, now I only allow 20. Is this a bad idea? I've had a lot of traffic on my node, and everything seems to be working fine (although connecting initially took forever) according to the numbers, but i can't retrieve much. ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.su pport Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED] ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support Or mailto:[EMAIL PROTECTED]
RE: [freenet-support] FreeBSD : IPAddressDetector : SocketExceptiontrying to detect NetworkInterfaces
This is not a problem with freenet. I might be a JVM bug.. Maybe it has something to do with IPv6/IPv4 interfaces or something, do you have any IPv6 interfaces? Read here to see that this can happen wheter or not freenet is involved. http://thread.gmane.org/gmane.os.freebsd.devel.java/2866 And read here to see that we too have encountered the problem before and to learn the workaround I suggested at that time (please verify if it works). http://thread.gmane.org/gmane.network.freenet.support/1196 Regards /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Tapio Valli Sent: den 21 januari 2004 18:25 To: [EMAIL PROTECTED] Subject: [freenet-support] FreeBSD : IPAddressDetector : SocketExceptiontrying to detect NetworkInterfaces Correcting the *** header/subject, sorry about that. Hello, I am having difficulties my emails through to [EMAIL PROTECTED] I use that address but my mails haven't made it to list so far? Anyway, my problem below persists and now it appears to be blocking the connectivity for Frost client as Frost can't update lists and in freenet.log I am getting lots of these : Jan 18, 2004 1:20:46 PM (freenet.node.IPAddressDetector, QThread-879, ERROR): No addresses found! Jan 18, 2004 1:20:57 PM (freenet.node.IPAddressDetector, QThread-856, ERROR): No addresses found! Jan 18, 2004 1:21:08 PM (freenet.node.IPAddressDetector, QThread-879, ERROR): No addresses found! Jan 18, 2004 1:21:19 PM (freenet.node.IPAddressDetector, QThread-894, ERROR): No addresses found! Jan 18, 2004 1:21:29 PM (freenet.node.IPAddressDetector, QThread-896, ERROR): No addresses found! Please refer to below email for more details : On Thu, 15 Jan 2004 19:09:44 +0200 Tapio Valli [EMAIL PROTECTED] wrote: Hello, I am running the stable 5060 build with following system : javavm -version Java HotSpot(TM) Client VM java version 1.4.1 Java(TM) 2 Runtime Environment, Standard Edition (build Blackdown-1.4.1-01) Java HotSpot(TM) Client VM (build Blackdown-1.4.1-01, mixed mode) FreeBSD 5.2-CURRENT My freenet.conf should be ok as well as my NAT/port forwarding. Right at start-up of the node, I get : Jan 15, 2004 6:53:38 PM (freenet.node.Main, main, NORMAL): Read node file Jan 15, 2004 6:53:42 PM (freenet.node.IPAddressDetector, main, ERROR): SocketException trying to detect NetworkInterfaces java.net.SocketException: Bad address at java.net.NetworkInterface.getAll(Native Method) at java.net.NetworkInterface.getNetworkInterfaces(NetworkInterface.java:2 04) at freenet.node.IPAddressDetector.checkpoint(IPAddressDetector.java:96) at freenet.node.IPAddressDetector.getAddress(IPAddressDetector.java:68) at freenet.node.IPAddressDetector.getAddress(IPAddressDetector.java:49) at freenet.node.Main.main(Main.java:605) Jan 15, 2004 6:53:45 PM (freenet.node.Main, main, NORMAL): starting filesystem But the node starts anyhow. How significant is this and what I can do to fix it? When running, I get these, like 2-3 times a minute. Thanks, Tapio Valli -- -- ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
Re: [freenet-support] access to freenet using windows98
Yes, you should update. Try the 'update snapshot' link in the Freenet folder in your start menu. Cheers /N - Original Message - From: william johnston [EMAIL PROTECTED] To: [EMAIL PROTECTED] Sent: Tuesday, January 20, 2004 5:20 PM Subject: [freenet-support] access to freenet using windows98 Hello. I have had a similar problem with freenet outlined by another windows98 user, having installed it from free cdrom. Everything went ok, user node set up, etc. Initially it was prob with zonealarm firewall next time tried,so I shut that down, and was able to open the gateway fine. but then couldn't access any of the sites listed, with similar time out messages. I only have connections to about 2 out of 20 nodes at any one time from looking at the usage and network info, so guess that is the problem, as I see most here seem to have many more, but not sure what to do to improve this figure, or get further. Have in the past installed linux os variants on a virtual partition, but now have no space for that, so prefer to stick with 98 for the time being. Thanks for any help Will ps using version 0.5.2.7 - should I update, and how do I get the download? ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
Re: [freenet-support] Odd failure(?) mode, and updating.
- Original Message - From: Paul Derbyshire [EMAIL PROTECTED] To: [EMAIL PROTECTED] Sent: Friday, January 16, 2004 8:30 AM Subject: [freenet-support] Odd failure(?) mode, and updating. You may remember me as the one who had problems with fproxy that proved to be brain-dead IE defaults. Turns out fproxy and my node are working fine, and the node gets around 1 request a second suggesting it's integrating way better than the freesite of evil keeps bitching about. :) Reachability of stuff browsed through the interface seems to improve as it gels into the network. Good to hear, that is one of the reasons the why it is good to run a permanent node. Then this AM there was an incident, which happened to catch me in front of the keyboard. It was hard not to notice, since the whole system became largely unresponsive. For whatever reason, my node had spawned over 5000 new threads in a matter of seconds and bloated to take up much more RAM and most of the CPU, forcing me to restart the service from the tray menu. Hopefully enough is cached between sessions that this won't seriously compromise the node's integration. I have a number of new questions, none of which the FAQ will answer. 1. What caused this? I've heard of some versions grabbing a lot of system resources when inserting certain kinds of keys locally through FCP, but not spontaneously or as a result of requests. Can it happen when some kinds of keys are inserted by just propagating to your node? Was it trying to upload and store a large file, maybe one that came in 5000 asynchronous fragments? Pathological behavior that cripples the host system until the node is restarted manually, possibly then hurting the network by interrupting what would have been an important task for others or by setting back the integration clock on your node is, IMO, bad. Thread, CPU, and memory use may need to be throttleable as bandwidth currently is. (The same applies double to the gnutella client I run, though, which frequently bloats up to 2000 threads and uses way more ram than the freenet node under normal circumstances -- i.e. normal for the node AND the gnutella client. :)) The theory is that this happens when the node finishes a huge bunch of stuff at the same time (for instance when we have queued lost of messages to another node and then that dies.. suddenly we have large amounts of failure messages to handle). And.. even worse, when the node has huge amounts of threads running it will have problems catching up since we all the time receives more messages etc over the network that are supposed to be processed - even more threads spawned 2. Is this already addressed by the update? It is in the version you are running even.. set the config param 'threadFactory=Y' in the freenet.ini file (dont forget to remove the '%' comment sign). This will cause your node to use another threadfactory which respects the tfAbsoluteMaxThreads param (which defaults to 500 or so) 4. My machine seems to get a new IP address every so often, automagically, and not just after a reboot. How well will the node handle that?: It checks periodically. a. Will it start screwing up if the IP changes mid-session and have to be manually restarted? How to detect this or better yet, automate it? Short of restarting it on a fixed schedule, which would probably be bad. Or will it discover the new ip for itself? Perhaps as long as it works OK without uncommenting and changing the ipAddress line in freenet.ini it will cope automatically? Yes b. How bad an effect on the network will the dynamic IP have, especially if it requires periodic node restarts beyond the usual Windows had a cerebral embolism in its atrophied and still largely 16-bit brain; time to reboot again, sigh situations? I'd rather avoid the dyndns.org service that I was shocked to find pimped in a comment in the configuration file. Shocked, because of this from its Click-through Terms of Service Of The Week(tm by Microsoft who pioneered the practise): Sure, a fixed IP would of course be better but fred is designed to cope with IP changes (read up on what ARK's (freenet only term) are if you want details) /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] Which JRE is recommended for Win2k
I'm running with the IBM JVM 1.4.1 wich has (at least under linux) dramatically better performances than the SUN JVM. And is not available for windows yet :( I am running 1.4.2_03 and cannot say I am seeing any problems that are caused by the actual JVM version... /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] Re: Which JRE is recommended for Win2k
-Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Someone Sent: den 16 januari 2004 13:51 To: [EMAIL PROTECTED] Subject: [freenet-support] Re: Which JRE is recommended for Win2k Herve Lefebvre schrieb: What kind of errors ? I already reported them here and mailed some log files to toad. or maybe a configuration problem. It is mainly on default configuration, I just had to reduce the max connections to 80 because of my cheap SOHO router. And with the builds previous to 5054 (the non mux builds) it run for days without errors in the log, CPU and memory usage was quite high but it didn't stall. I'm running with the IBM JVM 1.4.1 wich has (at least under linux) dramatically better performances than the SUN JVM. Is there a stand alone JRE from IBM? I just found the big JDK for Windows, which isn't good according to the readme of fred. Does it really include the 1.4.1 JVM or does it only include the 1.3.1 one? If it includes 1.4.1 I'd really much like to know where I can download it. /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] 5061 Observations questions
-Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Kevin Steen Sent: den 16 januari 2004 12:35 To: [EMAIL PROTECTED] Subject: [freenet-support] 5061 Observations questions Some observations from my 5061 node, ocmContents page (and the resulting questions to enhance my understanding of what's going on.) : Established node, restarted and run for 2 hrs: Total amount of messages transfered Type Sent/Received DataNotFound 28/58 InsertReply 1/1 StoreData 16/12 Accepted 28/57 NodeAnnouncement 0/3 QueryRestarted 28/59 InsertRequest 56/25 DataReply 16/17 QueryRejected 29/65 DataInsert 1/5 DataRequest 67/29 QueryAborted 3/3 + Shouldn't sent InsertRequests always be = received InsertRequests? (i.e Inserts from others + local inserts?) I have 56/25 without doing any local inserts. Some of your InsertRequest where QR:d by the receiver - Your node sent them to another node. + Is there a timeout on data waiting to be transmitted? My node seems to get to approx 100KiB waiting and then everything stops changing on the Messages transferred display. The data waiting goes up and down about 5Kib, indicating something is happening, but none of the message counts change. + How long until references are removed? Some of my Routing Table entries still contain more than rtMaxRefs entries after 48 hrs. Do they stay until the node is dropped from the routing table? Hmm.. Did you decrease your rtMaxRefs value in order to make the number of refs break the boundary? Usually refs are replaced with new ones when a new one from that node comes along or so.. + How long until nodes are dropped from the routing table? They are never dropped, they are just replaced by other nodes (I think). + What causes synchronisation between inbound outbound bandwidth? Only my outbound bandwidth is limited (512/128 cable connection) but inbound quickly stabilises at approx 90% of outbound. Nothing does it explicitly. A couple of things might cause a non-explicit sunc though, for instance: 1. If all data your node is sending actually is relayed from other nodes your outbound bw will never be larger than your inbound one. 2. Your node will usually not send a message unless it receives one and when it so does it will send at least one message. Regards /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] Helping with website a little question...
Hello, I'd like to help freenet creating a translated into french website, and also writing so docs or HOWTO etc. Wonderful BTW, I've already written some articles about freenet such as http://www.linuxfrench.net/article.php? id_article=597 but the comments are we dont understand anything on the website or I cant fetch any document etc. That's why I'd like to write some french docs and translate the web site. Who should I contact ? I would suggest the project leader Ian Clarke, [EMAIL PROTECTED] He will most likely read your mail very soon. :) Who is maintaining the website ? No-one and everyone Is the website maintained through a CVS ? It is. Otherwise, a little technical question. My node is _always_ overloaded (due to BW limit 128Kb/s), and my routing table knows only 50 other nodes even after some days of uptime. Do I have a problem with my node, or others have also these kind of values ? Nope, that is perfectly normal.. The overload issue is beeing worked on continously and 50 is the default configuration value for how many other nodes the node should try to route to. /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] New node not working...500 server errorfrom 127.0.0.1:8888.
I never changed the browser configuration when I went from dial-up to cable. Then again, since it is a Microsoft product, maybe it's going around changing things behind my back and exercising more autonomy than it should. I'll check... All there is in LAN settings (which I assume will be used for anything going through the network card, including cable inet) is automatically detect settings. There's a bypass proxy server for local addresses option, but checking it would require taking off automatically detect settings and setting who knows what else to make normal Web browsing work again. 'Automatically detect settings' makes IE hail your ISP for proxy configuration and thereafter use the proxy the ISP gives you back for every single web page you are fetching from the net... Seems that the problem here is that your ISP has a broken automatic configuration script. This brokenness causes your your browser to ask the ISP:s proxy to fetch a page from itself and then send it to you.. A non-broken configuration script would make your browser ask your own machine for the page instead (and that is where it actually resides). Not using a proxy is 'normal browsing'. Just untick the 'automatically detect settings' checkbox and see if you can browse the web correctly that way.. You can always turn it back on again if it doesn't.. This feature is mostly used in enterprises, not so much for home internet connections. Why on earth is this proving to be so complicated... *sigh* No other p2p software I've got has had the slightest hiccup associated with the transition to cable -- the speed boost and stabler connections are all they seem to notice. :) Try accessing BearShares localhost web interface for instance.. Same thing ought to happen Also, browsing locally hasn't been affected before, now that I think of it. Several things on my system have documentation in plain-jane HTML, notably GTKRadiant, and those render OK in IE. Seems like it has no problem with static local content, only local services on loopback? Most of those documentation page doesn't come with a web server serving them.. The problem has nothing to do with the actual content but rather with how it is delivered to the browser If the url is something like file:///yyy/zz.html the files are read directly from your local drive If the url is something like http:///yyy/zz.html the files are requested from a web server running on machine '' The proxy settings in IE only applies to http server connections. ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] Stable build 5055 crashes under Linux
Yup. This means that the newest item in your datastore has a timestamp that is larger than what your current system clock says the time is. Have you modified the clock on the machine or similar recently? I recommend that you locate those files in your ds that is timestamped in the future and reset their timestamps to now (touch maybe). Or.. If it only is a matter of minutes.. Restart the node after those minutes have passes. /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Justin The Cynical Sent: den 13 januari 2004 09:56 To: [EMAIL PROTECTED] Subject: [freenet-support] Stable build 5055 crashes under Linux *sigh* I got the message about the new build and the reports that it's faster than the older builds. Yippie! So, I run update.sh, delete the old freenet.log, touch it, and start the following command as nobody: sh start-freenet.sh ; tail -f ./freenet.log And here is what I find in my log: Jan 14, 2004 12:34:20 AM (freenet.node.Main, main, NORMAL): Starting Freenet (Fred) 0.5 node, build #5058 on JVM Sun Microsystems Inc.:Java HotSpot(TM) Client VM:1.4.2_03-b0 2 Jan 14, 2004 12:34:22 AM (freenet.node.Main, main, NORMAL): loading node keys: node Jan 14, 2004 12:34:22 AM (freenet.node.Main, main, NORMAL): Read node file Jan 14, 2004 12:34:23 AM (freenet.node.Main, main, NORMAL): starting filesystem Jan 14, 2004 12:34:26 AM (freenet.node.Main, main, ERROR): Unexpected Exception: freenet.fs.dir.DirectoryException freenet.fs.dir.DirectoryException: Clock skew at freenet.fs.dir.NativeFSDirectory.verifyList(NativeFSDirectory. java:2042) at freenet.fs.dir.NativeFSDirectory.init(NativeFSDirectory.java:943) at freenet.node.Main.main(Main.java:684) Obviously, it's not going any further. Any ideas? Justin ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.su pport ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
[freenet-support] Stable build 5052
Freenet stable build 5052 is now available. Changelog: * tfAbsoluteMaxThreads config parameter added. tfAbsoluteMaxThreads will allow you to limit maximum number of threads the YThreadFactory will spawn. Default value is 500 threads. This solves at least some of the OutOfMemoryError:s people are encountering. ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] Freenet under Linux issues
On Wed, 10 Dec 2003 10:54:24 +0100 Niklas Bergh [EMAIL PROTECTED] wrote: Also, when I try clicking on Spread Freenet, I get a blank page that says nothing more than 'Error'. ?? Justin Does the link take you to an URL which seems right? It doesn't show me anything but that word, no links or URL's. Bah.. I didn't ask about the page.. I asked about the URL (it can usually be seen in the 'Address' field of the browser). Alternatively, chek where the link you click to get to the distrubution page lead to? This is displayed by most browsers somewhere when you hover the mouse. The windows version doesn't seem to understand that I set the ini to make it a perm node, so it refuses to even try. Maybe it cannot? Have you configured the Ipaddress properly if you are NAT:ed? Have you read what it says in the log? /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] multiple nodes inside a NAT network??
Just curious as to the logistics of multiple nodes behind a NAT'ed firewall. I can have each of them have different listen ports and forward the ports to the correct node, but what will nodes outside the network think of multiple nodes to the same IP? Will the nodes in the network learn to talk to each other dirrectly? Will there be any proformance impact? Thanks! It ought to work just fine.. The network definitely has nothing against multiple nodes seemingly running on the same host. Your nodes will talk to each other through the NAT firewall (assuming is manages to route the connections correctly.. It should do that). Not much of a performance penalty should come from this. /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] node references
i am updating my node references. the message says this should only take a minute. It has been saying that for over ten minutes now . is that normal? Nope.. Try downloading the seednodes.ref file manually from http://freenetproject.org/snapshots/seednodes.ref Put it in the 'Freenet' folder on your harddrive and restart the node to make use of it. /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] number of connections + question about node refs
I've limited the amount of connections my node can make to 50. I don't know how this effects the network, how it effects my node's ability find files or anything, all I know is this keeps freenet from eating all of my system's resources. Please tell me if their is a better way. What kind of resources? Memory, CPU or bandwidth? The main argument for allowing more connections to be open is that it is very expensive (CPU-wise) to open a new connection.. If you allow for more connections to stay open then less connections will need to be opened. Also.. You should never allow less than 2*50 connections if you are running with the default routing table size since the node needs to be able to keep two connections open per entry in the rt. /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] Freenet under Linux issues
Also, when I try clicking on Spread Freenet, I get a blank page that says nothing more than 'Error'. ?? Justin Does the link take you to an URL which seems right? /N ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] Is there a user forum anywhere
Or come visit in #freenet on irc.freenode.net /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of [EMAIL PROTECTED] Sent: den 8 december 2003 21:30 To: [EMAIL PROTECTED] Subject: Re: [freenet-support] Is there a user forum anywhere Is there an English language forum anywhere on the WWW (or elsewhere) where Freenet users can assist each other? That might be too anonymity-compromising for a lot of users. Why not use Frost or maybe IIP? For those who don't mind non-anonymous communication (and have an account on Livejournal), there's a newly-created freenet community on there: http://www.livejournal.com/userinfo.bml?user=freenet -- 9:28PM up 21 days, 28 mins, 2 users, load averages: 0.24, 0.29, 0.26 Every non-empty totally disconnected perfect compact metric space is homeomorphic to the Cantor set. ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support ___ Support mailing list [EMAIL PROTECTED] http://news.gmane.org/gmane.network.freenet.support
RE: [freenet-support] Insert file by URI
Yes, it is a known one that hasn't been fixed yet /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Hiu Sing Ngai Sent: den 2 december 2003 11:27 To: [EMAIL PROTECTED] Subject: [freenet-support] Insert file by URI Hello, I'm trying to insert a file to freenet with the webinterface. The insertion has been successed but no CHK key has returned. Only freenet:CHK@ has returned. Is this a bug? Thanks! Do you Yahoo!? Free Pop-Up Blocker - Get it now ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Instead of getting smarter, My node seems to get dumber
Steven When you request a web page or similar from the network your node selects where to forward that request to. In certain circumstances your node cannot find a place to send the request on to, that is when you get that message. To see the list of other nodes that your node will forward requests to have a look at 'http://localhost:/servlet/nodestatus/nodestatus.html', if most of the nodes are blue you will see trouble, if most of the nodes are red then you might see some trouble. To weed out any 'bad' nodes from your routing table you have to let your node run for prolonged periods of time (permanently would be prefered). Also, since last weekend the network is undergoing severe changes, probably reinforcing your problems quite a bit. Btw, are you running the latest build (5046)? /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Steven Sent: den 1 december 2003 09:42 To: [EMAIL PROTECTED] Subject: [freenet-support] Instead of getting smarter,My node seems to get dumber So far I have completely Demilitarized my computer running the node (placed it outside of my linksys router's firewall), registered an account with dyndns in order to run a permanent node (which finally works) tried stable and unstable releases, and am still having the same problem... When I start my node, some (maybe half) of the links work (they load so fast that i wonder if they are not simply cached on my node already). When I click dead links i get an error that tells me to try higher HTL's and stuff. A few hours go by, and I think that things will improve as my node learns more about the network, instead, when I click dead links I get a different error: Your request couldn't even make it off the node. I look around at all of the diagnostic information to maybe find out if I was somehow completely cut off from the network, but in the open Connections area, there are like 25 different connections to about 12 different IP's. Data is flowing to and from these different nodes, so I know I'm not cut off completely. my load indicator usually stays between 15 and 30, and is usually steady at around 25. If I stay connected to the network in this state for long enough, will my node learn enough to once again make requests to other nodes? Do I need to reseed and restart? Is this normal activity for a node? Is there something obvious that I'm missing? ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi- bin/mailman/listinfo/support ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Unable to start after an insert
What does the log file say? /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Thad Eckard Sent: den 25 november 2003 19:37 To: [EMAIL PROTECTED] Subject: [freenet-support] Unable to start after an insert I just realized that I think I'm having a problem. I made an insert over the night, woke up and stopped Freenet for about two minutes, then tried to re-start it. Now, Freenet keeps trying to start with no success. The blue arrowhead objects behind the rabbit just keep running up. I'm using 5039. _ Groove on the latest from the hot new rock groups! Get downloads, videos, and more here. http://special.msn.com/entertainment/wiredform usic.armx ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi- bin/mailman/listinfo/support ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Negative Local Ports
That are supposed to build up until the maximum connection limit is reached.. At that point they will start to get dropped whenever a new connection arrives.. Can this be the cause of what you are seeing? /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Richard Thomas Harrison Sent: den 20 november 2003 09:29 To: [EMAIL PROTECTED] Subject: Re: [freenet-support] Negative Local Ports -BEGIN PGP SIGNED MESSAGE- Hash: SHA1 Niklas Bergh randomly hit the keyboard and managed to write on 19/11/2003 09:21: | Btw. This should now be 'fixed' in latest cvs. Textual descriptions | will be displayed instead of those negative numbers. So it does (unstable 6342). However, they don't close and build up. I have sent a very large file to this list (about 230k) about this. Unsurprisingly it has been held back for approval before being posted (or not) to this list. Richard - -- - -- -- CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCGCGCACTTATGCCTCAATAGATC TGCCACATCG CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGAAGTGTGGCATCCT TTTGCTTCAG dna.pl v0.2.4 (c) 20020613 (tm) rich at mibnet.plus.com -BEGIN PGP SIGNATURE- Version: GnuPG v1.2.3-nr1 (Windows XP) Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org iD8DBQE/vHs9DehCPPrjI9gRAt/aAJ0Y6KfxjJdS2wptO1QmzE6fDtprxwCfVF5L T2ZD61GcG8UERF4tJjpKTZ8= =WmTa -END PGP SIGNATURE- -- ** ** This message has been swept clean of viruses by AVG Anti Virus email Scanner. http://www.grisoft.com/html/us_index.cfm Checked by AVG anti-virus system (http://www.grisoft.com). Version: 6.0.541 / Virus Database: 335 - Release Date: 16/11/2003 ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Negative Local Ports
Btw. This should now be 'fixed' in latest cvs. Textual descriptions will be displayed instead of those negative numbers. /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Niklas Bergh Sent: den 19 november 2003 10:07 To: [EMAIL PROTECTED]; [EMAIL PROTECTED] Subject: RE: [freenet-support] Negative Local Ports These are a programmatical thingy.. They tend to mean that something is wrong with the connection in question.. Maybe not fully opened yet.. Maybe on its way to closing. Check the mailing list archives for an exact description. /N -BEGIN PGP SIGNED MESSAGE- Hash: SHA1 For sometime now (3 or 4 weeks I think) I have been noticing -ve Local Port numbers being reported in the Open Connection Manager screen (Connection Mode). It does not seem to be associated with the remote node build since atm I have 3 connections to a node, 2 with -ve numbers and 1 with a +ve number. I might add that I have 67 other connections to other nodes before you have a heart attack. All other Local Ports are in the range of 3000 to 5000. The negative Local Port number is -5 for both. Just rechecked and all 3 connections to the node are now -5. C:\USR\LOCAL\Freenet0.5 [\\VIXEN\Richard]$ ver Microsoft Windows XP [Version 5.1.2600] C:\USR\LOCAL\Freenet0.5 [\\VIXEN\Richard]$ java freenet.Version Freenet: Fred 0.6 (protocol 1.47) build 6339 (last good build: 6280) C:\USR\LOCAL\Freenet0.5 [\\VIXEN\Richard]$ java -version java version 1.4.2_01 Java(TM) 2 Runtime Environment, Standard Edition (build 1.4.2_01-b06) Java HotSpot(TM) Client VM (build 1.4.2_01-b06, mixed mode) Will install 6340 and check with that. Probably take some time to spot it though as it doesn't happen very often. Richard - -- - -- -- CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCGCGCACTTATGCCTCAATAGATC TGCCACATCG CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGAAGTGTGGCATCCT TTTGCTTCAG dna.pl v0.2.4 (c) 20020613 (tm) rich at mibnet.plus.com -BEGIN PGP SIGNATURE- Version: GnuPG v1.2.3-nr1 (Windows XP) Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org iD8DBQE/uzFyDehCPPrjI9gRAhVdAJ4vKRMTQxApFfHGEnB38web3aOAgQCfb5N+ 9PrmpUDUqEeAPgXapjUw6Pk= =Qpl2 -END PGP SIGNATURE- -- ** ** This message has been swept clean of viruses by AVG Anti Virus email Scanner. http://www.grisoft.com/html/us_index.cfm ** ** Checked by AVG anti-virus system (http://www.grisoft.com). Version: 6.0.541 / Virus Database: 335 - Release Date: 15/11/2003 ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/suppor t ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] Freenet Stable Build 5039
Or.. as NGR would do it.. Hmmm.. that node is one slow sucker.. better send the query to another one next time. /N - Original Message - From: TLD [EMAIL PROTECTED] To: [EMAIL PROTECTED] Sent: Wednesday, November 19, 2003 6:07 PM Subject: Re: [freenet-support] Freenet Stable Build 5039 This build turns off rejecting queries based on output bandwidth usage, a feature that is unnecessary (we have other ways of limiting bandwidth usage) and counterproductive to routing. Maybe so, but I doubt having a Data waiting to be transmitted value above 30 minutes worth of transmission (with full bandwidth usage) is good for the routing, either. I noticed the value notably lower in the latest builds (in the order of 5-10 minutes) with the bandwidth usage-based queryreject; I hope things won't get Mighty Bad again :) Might a I have the key you need but my band is full and can't send it right now, try searching with the other nodes meanwhile and come back later if you really need it message help such situation? -- /~\ The ASCIITLD \ / Ribbon Campaign They that can give up essential liberty to obtain X Against HTMLa little temporary safety deserve neither liberty / \ Email! nor safety. -- Benjamin Franklin ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] Beginner... all I get isWaitingfor127.0.0.1... ...follow-up
3. I'm behind a software firewall, and have set local host to the firewall IP, with port forwarding to my machine. Is that correct? Do you mean the configuration parameter named IPAddress? (I don't know if windows users see the actual parameter names or not). Or have you set 'localhost' to the firewall IP in your 'host' file? If so... change it back, it should never ever point to another machine.. /N ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] Can't receive any Freenet data
Actaully, this might be caused by a bug releated to seednodes reading which is solved in build 5033 (the absolute newest one).. Could you try upgrading to that build and also download http://freenetproject.org/snapshots/seednodes.ref and replace your local seednodes.ref file with this one... regards /N - Original Message - From: [EMAIL PROTECTED] To: [EMAIL PROTECTED] Sent: Saturday, November 15, 2003 2:58 AM Subject: Re: [freenet-support] Can't receive any Freenet data This is sadly a common first user situation. Exactly what happened? Did you try to fetch the links on the Web Interface page? Even under ideal conditions a node takes a while to become fully functional (current estimates are around 24 hours for a node to be reasonably useful). 24 hours are a long time for just a single connection. I allways get the following error: Couldn't Retrieve Key Couldn't connect to the network. Are you sure you have configured Freenet correctly? Also make sure that you are connected to the internet. when trying to connect to a freenet link like: http://127.0.0.1:/[EMAIL PROTECTED]/TFE//?htl=15try=3 I note that you haven't showed the external internet address of the router. Did you add it to the freenet.conf file?: ipAddress=82.65.12.3 or ipAddress=amphibian.dyndns.org [ using dyndns is a common solution for such setups, they are a free dynamic DNS provider, www.dyndns.org ] I didn't showed it because the external ip changes allways automatically after the login to my ISP. I just started the router and then i used the IP the router get from the ISP after the login in the freenet.conf file, after editing the freenet.conf file with the new ip i started freenet. Also, did you remove the % at the beginning of the line? No sorry i forgot it. But i removed it a few minutes ago and tried it again but still no success. I still get the above mentioned error message. Do i really have to wait 24 hours for the first connection success message? Those are the iptables firewall rules i used for accesing freenet: iptables -A FORWARD -j ACCEPT -o ppp0 -p tcp \ -s 192.168.100.8 --sport 1024: --dport 23030 -m state --state NEW,ESTABLISHED,RELATED iptables -A FORWARD -j ACCEPT -i ppp0 -p tcp \ --sport 23030 -d 192.168.100.8 -m state --state ESTABLISHED,RELATED iptables -t nat -A PREROUTING -i ppp0 -p tcp --dport 23020 -j DNAT --to-dest 192.168.100.8 Ok. Tell me your IP address and I will check connectivity. Or come to #freenet on irc.freenode.net, we will see if we can help you. Ok i just tested on the Shield UP website (a port scanner - http://grc.com/ ) if the port 23030 is open. The results where: Port: 23030 Status: Open Protocol and Application: Unknown Protocol for this port Unknown Application for this port Seems to me that this is working. I do not know if it is a firewall rules problem. Check the Open Connections page, do you have incoming connections? No, the Open Connection page shows the following: Connections open (Inbound/Outbound/Limit) 0 (0/0/512) Connections transferring (Receiving/Transmitting) 0 (0/0) Bytes waiting to be sent None Best Regards, Oliver C. ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] freenet load always 100%
I'm not seeing this but now that the world seems to have discovered my node, my JVM keeps dying with out-of-memory and NULL pointer exceptions. I still have plenty of (virtual) memory left, so something else must be serving as a cap on the memory that java can get. This might be a java tuning parameter or a kernel setting (I'm using FreeBSD 4.9-STABLE), but if anybody has any clues I'm appreciate it. My current solution of shutting down freenet every time it happens and restarting it is getting old fast especially since that's getting to be about every hour now. OOM:s usually causes NPE:s as a side effect. To allow java to use more memory spawn your node with something like 'java -Xmx256M XX'. Depending on which JVM version you are running the default maximum amount of memory the JVM will use is either 64 or 128 megs which is usually too little memory for a popular node to work well. /N ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Re: route not found
To fix this, I've enabled all outgoing packets for all programs in ZoneAlarm (expert rules), but I'm afraid this may not be the best idea from a security point of view. Well.. It isn't good from that point of view if you suffer from problems with trojans and other stuff (=you run stuff on your computer that you don't know that you do).. It makes no difference for otherwise. /N ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Re: [freenet-support] Re: 5029 overloads
I am using YThreadFactory (obviously) and maximumThreads=300. Also, I'm allocating 128MB to java memory. I'll keep it running until the outgoing bandwidth gets really low. Recommendations? Or does this indicate a bug needing to be fixed? -Martin Given the amount of requests your that your node receive 128M probably isn't enough Try for a while with 192M or so. Well, Muxing and SIPv2 will both lead to decreased memory usage. Muxing will affect memory useage directly due to decreased amount of connections while SIPv2 will lead to decreased CPU which probably will cause some memory savings due to decreased enqueueing of stuff. /N ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Rantsies
Good to hear. Wonder if it is because of working NGR or simply because the unstable network is smaller.. I believe that this isn't known yet. Don't things work better when it's bigger? :-) It should do.. If routing was working well and able to cope with the growth and load balancing. Hmm.. Well.. Actually they both speak exactly the same language.. The Then, no reason why 'stable' couldn't actually talk well with other stable nodes and ngr ones? And just keep the unstable only dealing with ngr for testing? As of yesterday there where three types of nodes.. Stable, all non-NGR Unstable, anti-NGR (build 6281) Unstable, NGR (build 6281+) The previous two types could talk to each other.. The last type could only talk to its siblings Hmmm.. Not play really.. The intention is to make it work... Perception skewers reality. I don't know WHY unstable works, but I see that it does. I tested again yesterday with stable (getting new seednodes) and I still couldn't *do* anything. Ie, couldn't retrieve any 'known' keys. So, either all the linked content just isn't there any more on 'stable', or something is still broke. Whether by luck or talent, it seems that they have gotten unstable 'working'. Possibly anti-NGR... Probabilistic caching. Prevent nodes from caching data whose source they aren't routing-wise close to. Why? I don't understand this... ideally, shouldn't a node cache *everything* that runs through it, given enough space? It does, until the DS is 90% full.. After that it tries to enhance specialization by selectively accept stuff into its store.. NGR Keep track of not only which nodes have what data.. Also keep track of how fast they can supply it. Err, um... keep track of what nodes have what data? That doesn't sound like a good idea at all. Hopefully, you mean, keep track of what nodes can GET what data. I hope, at least, that would be the way it works. No, I don't have the GPL, but I know someone who can get it for ya... I'm just passing your request on... Right, my mistake.. Problem #8: OCO. Massive amounts of CPU is used for connection negotiations due to heavy encryption stuff used in there. OCO amplified this latent issue. I read Toad's roadmap, and it seems that at least udp is being considered. Great. This is how it SHOULD be done: Or, at least, an option. If you're on lower bandwidth, udp should be fine, no? And solves having a ton of connections always open. It'd put more load on the machine, but, probably still acceptable. The problem is not the TCP connections.. It is all about FNP connections (currently over TCP but they would have the same problem even over UDP). The problem is that two nodes has to autheticate with each other to verify that the Peer is who he says he is.. This is true no matter if the underlying transport would be TCP or UDP. 1. Multiplexing, would allow a single connections to send multiple messages simultaneously thereby enabling us to keep only one single connection open to each node, compared to keeping one free connection the each node. Ah, so THAT is why I see so multiple instances of a node in the OC window? Because this is yet to be done? Yep. If someone wants to add missing things to the list then feel free to do so. That's a pretty nice list, and certainly gives me a new perspective. Good, that was the intention :) There is no play involved.. Most everything is done for a quite good reason :) Nahh.. They don't really dismiss it.. They just want things to start working at all first :) Any help would be very appreciated. I think they're doing a good job with unstable. It just is non-intuitive that your best hope is NOT to get the stable release: I think it'd be helpful for the main page to reflect that unstable isn't really so much 'broken' as 'in need of constant update'. Meaning, if you are downloading the latest build each day, chances are you're probably be better off than downloading the stable at all. But, that's just my experience so far. Usually stable is the best hope.. It is just that here has been a rough couple of months lately.. /N ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Help Respond Soon
What kind of error messages do you see? And also are you using some kind of broadband router/software firewall /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Red Dem0n Sent: den 25 oktober 2003 23:39 To: [EMAIL PROTECTED] Subject: [freenet-support] Help Respond Soon I've been trying to get this Freenet to load the websites but its not doing it at all. I have been leaving it on for a long time now. Right now I have 2.40ghz, 768DDRRAM, and cable modem. I would like to know what I should set my settings to so I can get the best results possible and make the pages load more faster, because I havent been able to get any to load except the main page which takes forever to load the little images. ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi- bin/mailman/listinfo/support ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] browser
Title: Message How about using the 'Address' field then? I allows you to navigate to ANY web page in the whole wide world. Also, you can type in any start page you want in 'Tools\Internet Options\Home page'. If that doesn't work then I would suggest that you have a talk with Microsoft. And if you cannot remember the address of your previous 'Earthlink' start page then I suggest you have a talk with Earthlink. /N -Original Message-From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Robert GreenageSent: den 29 oktober 2003 15:08To: [EMAIL PROTECTED]Subject: [freenet-support] browser freenet has co opted my browser. when i log on to the net my browser would default to my ISP(earthlink) homepage.now it defaults to 127.0.0.1:. i cannot get it to go to any other website. even by using favorites or history. the default browser for earthlink is IE 6.0. this also happens to be how i access my mail. any ideas? --- Robert Greenage --- [EMAIL PROTECTED] --- EarthLink: It's your Internet. ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: [freenet-support] Re: Support Digest, Vol 3, Issue 38
Hmm.. Ok, so what exacltly is it that doesn't work for you? Is it getting the ActiveLinks in the web interface? Is it navigating to a freesite? If it is the second then you should get a message saying something like 'Route not found' or possibly 'Data not found' or something.. What does the page you get say? /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Red Dem0n Sent: den 29 oktober 2003 16:02 To: [EMAIL PROTECTED] Subject: [freenet-support] Re: Support Digest, Vol 3, Issue 38 I don't see any error messages at all, I figured maybe it was something due to the uptime of the program so i kept it on about 10-12 hours, and the only difference I saw was that when I started Freenet it was at a load of 100%, after the 10-12 hours it was at a load of 0%. So I'm guessing there might be something wrong with the settings, although it is under the default settings at the moment. There's no router/software firewall I have right now so that couldnt be the issue. Message: 5 Date: Wed, 29 Oct 2003 10:54:30 +0100 From: Niklas Bergh [EMAIL PROTECTED] Subject: RE: [freenet-support] Help Respond Soon To: [EMAIL PROTECTED] Message-ID: [EMAIL PROTECTED] Content-Type: text/plain; charset=us-ascii What kind of error messages do you see? And also are you using some kind of broadband router/software firewall /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Red Dem0n Sent: den 25 oktober 2003 23:39 To: [EMAIL PROTECTED] Subject: [freenet-support] Help Respond Soon I've been trying to get this Freenet to load the websites but its not doing it at all. I have been leaving it on for a long time now. Right now I have 2.40ghz, 768DDRRAM, and cable modem. I would like to know what I should set my settings to so I can get the best results possible and make the pages load more faster, because I havent been able to get any to load except the main page which takes forever to load the little images. ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi- bin/mailman/listinfo/support -- ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi- bin/mailman/listinfo/support ___ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
RE: Longtime idle connections, was: [freenet-support] Build 659 (unstable)
And here comes the third dump of the ocm contents 155.239.180.179:34467 0 0 yes 1 0 572922365 QThread-12740 Inbound 33c0b6 80.134.237.85:21321 0 0 yes 2 0 533401428 QThread-25929 Inbound 7e5c44 80.134.237.85:15291 0 0 yes 8 0 484932664 QThread-34344 Inbound 5e833f 68.82.148.48:18230 0 0 yes 1 0 450711357 QThread-36576 Inbound 514847 129.240.200.147:39076 1 147772 yes 471 0 198812426 QThread-45337 Inbound 3c54ad 66.28.14.56:4732 1 1021207 yes 1740 0 173207288 QThread-45442 Inbound 6a5180 210.86.48.242:44180 0 0 yes 1 0 106259012 QThread-45049 Inbound f955a 134.193.75.29:3277 0 0 yes 11 0 198269616 QThread-45215 Inbound 1423d4 216.87.102.230:2816 0 0 yes 8 0 73175861 QThread-45395 Inbound 4e23b2 Please note that the same connections are still there.. plus some newcomers. The send-queue-size 147772 is also stalled (haven't changed in a couple of hours) Summary of current connections: Number of open connections: 120 Number of outbound connections: 1 Number of inbound connections: 119 Routing time status: # Current routingTime: 0ms. # Active pooled jobs: 276 (92.0%) [QueryRejecting all incoming requests!] Threadcount (maximumthreads is set to 300...): Total pooled threads 349 Available pooled threads 74 Pooled threads in use 275 And yes.. The node is just about idle now.. A couple of strange things I note though.. 1. The node is not *completely* idle.. There seems to be one or two threads that are still making themselves useful, accepting an incoming connection now and then and establishing a new outgoing connection once in a while. I assume that given enough time they will also be stuck however... 2. For some really strange reason: 'Local mean traffic (queries per hour) : 19399.68744947998'. This CANNOT BE TRUE.. My node is definitely not serving up any 20kQueries/h, close to no processor or bandwidth is used. Is the open-but-idle connections counted into this value for some reason?! /N -Original Message- From: Matthew Toseland [mailto:[EMAIL PROTECTED]] Sent: den 11 februari 2003 10:02 To: Niklas Bergh Subject: Re: Longtime idle connections, was: [freenet-support] Build 659 (unstable) On Tue, Feb 11, 2003 at 09:52:17AM +0100, Niklas Bergh wrote: -Original Message- From: Matthew Toseland [mailto:[EMAIL PROTECTED]] Sent: den 10 februari 2003 19:55 To: Niklas Bergh Subject: Re: [freenet-support] Build 659 (unstable) On Mon, Feb 10, 2003 at 11:38:09AM +0100, Niklas Bergh wrote: 659 seems to have solved the 'Node suddenly ceases traffic'-problem. I have a node that has been up for close 120 hours now and there is till no sign of stagnation. It is serving up 13000 q/h at about 1MBit/s. Yay. 1Mbps _both ways_ ? Nope, summed up. Most of it (80% or so) is outgoing traffic. One thing though: Peer addr Send Count Send Size Receiving Messages Idle time Lifetime Thread Type ID 155.239.180.179:34467 0 0 yes 1 0 393188783 QThread-12740 Inbound 33c0b6 80.134.237.85:21321 0 0 yes 2 0 353667846 QThread-25929 Inbound 7e5c44 80.134.237.85:15291 0 0 yes 8 0 305199082 QThread-34344 Inbound 5e833f 68.82.148.48:18230 0 0 yes 1 0 27095 QThread-36576 Inbound 514847 213.208.127.216:17565 0 0 yes 7 0 172335455 QThread-44615 Inbound 134183 64.252.121.1:34381 0 0 yes 10 0 22933808 QThread-45372 Inbound 323c46 216.15.192.235:56589 0 0 yes 2 0 42376945 QThread-42938 Inbound 13374f 134.193.75.29:3277 0 0 yes 8 0 18536034 QThread-45215 Inbound 1423d4 129.240.200.147:39076 1 147772 yes 471 0 19078844 QThread-45337 Inbound 3c54ad This is the initial entries of my ocm table. I do not like that idle-time always is zero on those connections where 'receiving' is 'yes'. It seems like the idletime is set to zero even if the connection is idle. Should it really be so, couldn't idle-time be set to indicate the time since the last packet was recieved on that connection instead?! Err... hmm. It is transferring a message with trailing fields i.e. a file. This can take a long time, but it is not idle during that time... Is the idle time specified in milliseconds? In that case, over the first connection, one message in 109 hours OCM 24 hours later: Peer addr Send Count Send Size Receiving Messages Idle time Lifetime Thread Type ID 155.239.180.179:34467 0 0 yes 1 0 470074608 QThread-12740 Inbound 33c0b6 80.134.237.85:21321 0 0 yes 2 0 430553671 QThread-25929 Inbound 7e5c44 80.134.237.85:15291 0 0 yes 8 0 382084907 QThread-34344 Inbound 5e833f 68.82.148.48:18230 0 0 yes 1 0 347863600 QThread-36576 Inbound 514847 213.208.127.216:17565 0 0 yes 7 0 249221280 QThread-44615 Inbound 134183 134.193.75.29:3277 0 0 yes 8 0 95421859 QThread-45215 Inbound 1423d4 129.240.200.147:39076 1 147772 yes 471 0 95964669 QThread-45337 Inbound 3c54ad 66.28.14.56:4732 1 1021207 yes 1740 0 70359531 QThread-45442 Inbound 6a5 Please note that this is the same connections as yesterday
RE: [freenet-support] Build 659 (unstable)
JVM 1.4.1_01 (always and ever until there is a newer one) -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED]] On Behalf Of Matthew Toseland Sent: den 6 februari 2003 19:48 To: [EMAIL PROTECTED] Subject: Re: [freenet-support] Build 659 (unstable) Are you sure you aren't using a nonstandard JVM? The IBM JVM has been known to have serious problems, as has Kaffe, and old versions of the Sun one sometimes have nasty bugs.. On Thu, Feb 06, 2003 at 10:26:25AM +0100, Niklas Bergh wrote: 659 would seem to have some problems with announcing. One of the nodes I upgraded yesterday hasn't done a single usefult thing since... Feb 4, 2003 5:39:20 PM (freenet.node.states.maintenance.Checkpoint, QThread-4): Executing Checkpoint: Native Filesystem Directory checkpoint Feb 4, 2003 5:39:21 PM (freenet.node.states.maintenance.Checkpoint, QThread-4): Executing Checkpoint: Autodetection of IP addresses Feb 4, 2003 5:39:31 PM (freenet.node.states.maintenance.Checkpoint, QThread-4): Executing Checkpoint: Autodetection of IP addresses Feb 4, 2003 5:39:31 PM (freenet.node.states.announcing.SendAnnouncement, QThread-6): Sending NodeAnnouncement failed: freenet.ConnectFailedException: Against peer DSA(eda1 570b d062 a746 1a54 e1cf 2800 9cf4 250f 5328) @ 193.11.247.167:61608 - Cannot connect to: 193.11.247.167:61608 (terminal) Feb 4, 2003 5:39:32 PM (freenet.node.states.announcing.SendAnnouncement, QThread-6): Sending NodeAnnouncement failed: freenet.ConnectFailedException: Against peer DSA(e3d9 6da2 c70f 7b75 0ad3 f077 236f bae0 6ed7 7e01) @ 217.215.123.28:19790 - Cannot connect to: 217.215.123.28:19790 (terminal) Feb 4, 2003 5:39:32 PM (freenet.OpenConnectionManager, QThread-5): Established connection: tcpconnection: 134.147.115.87:26277 Feb 4, 2003 5:39:34 PM (freenet.node.states.maintenance.Checkpoint, QThread-4): Executing Checkpoint: Native Filesystem Directory checkpoint Feb 4, 2003 5:39:39 PM (freenet.interfaces.PublicInterface, Interface # tcp/14166): Accepted connection: tcpconnection: 160.26.102.198:4620 Feb 4, 2003 5:39:40 PM (freenet.interfaces.FreenetConnectionRunner, QThread-4): Inbound connection failed: java.io.EOFException Feb 4, 2003 5:39:41 PM (freenet.node.states.maintenance.Checkpoint, QThread-4): Executing Checkpoint: Autodetection of IP addresses Feb 4, 2003 5:39:44 PM (freenet.interfaces.PublicInterface, Interface # tcp/14166): Accepted connection: tcpconnection: 217.84.0.234:4103 Feb 4, 2003 5:39:48 PM (freenet.node.states.maintenance.Checkpoint, QThread-10): Executing Checkpoint: Native Filesystem Directory checkpoint Feb 4, 2003 5:39:51 PM (freenet.node.states.maintenance.Checkpoint, QThread-10): Executing Checkpoint: Autodetection of IP addresses Feb 4, 2003 5:40:00 PM (freenet.node.states.maintenance.Checkpoint, QThread-10): Executing Checkpoint: Polling and aggregation of diagnostics. Feb 4, 2003 5:40:01 PM (freenet.node.states.maintenance.Checkpoint, QThread-10): Executing Checkpoint: Autodetection of IP addresses Feb 4, 2003 5:40:03 PM (freenet.node.states.maintenance.Checkpoint, QThread-10): Executing Checkpoint: Native Filesystem Directory checkpoint Feb 4, 2003 5:40:03 PM (freenet.node.states.announcing.SendAnnouncement, QThread-6): Sending NodeAnnouncement failed: freenet.ConnectFailedException: Against peer DSA(50a8 f534 ea52 f574 455c 00d9 5f7e e11d 2eb4 4570) @ 134.147.115.87:26277 - authentication timed out (terminal) Feb 4, 2003 5:40:03 PM (freenet.node.states.announcing.Announcing, QThread-6): Announcement failed to eda1 570b d062 a746 1a54 e1cf 2800 9cf4 250f 5328 at depth 15. Feb 4, 2003 5:40:03 PM (freenet.node.states.announcing.Announcing, QThread-6): Announcement failed to e3d9 6da2 c70f 7b75 0ad3 f077 236f bae0 6ed7 7e01 at depth 15. Feb 4, 2003 5:40:03 PM (freenet.node.states.announcing.Announcing, QThread-6): Announcement failed to 50a8 f534 ea52 f574 455c 00d9 5f7e e11d 2eb4 4570 at depth 15. Feb 4, 2003 5:40:04 PM (freenet.interfaces.FreenetConnectionRunner, QThread-4): Inbound connection failed: java.io.EOFException Feb 4, 2003 5:40:05 PM (freenet.interfaces.PublicInterface, Interface # tcp/14166): Accepted connection: tcpconnection: 129.116.44.183:33608 Feb 4, 2003 5:40:11 PM (freenet.node.states.maintenance.Checkpoint, QThread-10): Executing Checkpoint: Autodetection of IP addresses Feb 4, 2003 5:40:14 PM (freenet.interfaces.PublicInterface, Interface # tcp/14166): Accepted connection: tcpconnection: 217.84.0.234:4141 Feb 4, 2003 5:40:17 PM (freenet.node.states.maintenance.Checkpoint, QThread-6): Executing Checkpoint: Native Filesystem Directory checkpoint Feb 4, 2003 5:40:21 PM (freenet.node.states.maintenance.Checkpoint, QThread-6): Executing Checkpoint: Autodetection of IP addresses Feb 4, 2003 5:40:31 PM (freenet.node.states.maintenance.Checkpoint, QThread-6): Executing Checkpoint: Autodetection of IP addresses Feb 4, 2003 5:40:31 PM
Re: Longtime idle connections, was: [freenet-support] Build 659 (unstable)
I am not totally sure (starting the test today) but I *think* it does. I remember that I started noticing this problem when I first increased maxmimumThreads in order to make my node use up more of my available bandwidth /N ___ Support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org:8080/mailman/listinfo/support
RE: [freenet-support] Announcement problem
Nope, that is not it. I am *pretty* sure that this is the way: When announcing your node will send an announcement message with a specific HTL to 3 of the nodes in you routing table.. These three will in their turn distribute the announcement on to the best match in their routing table.. and so on until the HTL becomes zero.. Much like a plain insert. /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED]] Sent: den 11 februari 2003 15:50 To: Niklas Bergh Subject: RE: [freenet-support] Announcement problem At 12.53 11/02/03 +0100, you wrote: I have seen that earlier too but I haven't noticed it for a long time now.. I think that if your node has been running earlier and because of that is present in other nodes routingtables and thereby recieveing incoming connections everything should start working because of that... This is what I find strange; after announcement, I must be in routing tables of all nodes that are in my routing table this is the supposed way things works, isn't it ? Ciao. Marco /N -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED]] On Behalf Of [EMAIL PROTECTED] Sent: den 11 februari 2003 11:36 To: [EMAIL PROTECTED] Subject: Re: [freenet-support] Announcement problem At 02.45 11/02/03 -0500, you wrote: On Mon, 2003-02-10 at 20:07, Greg Wooledge wrote: Build 611? Are you sure about that? I have made contact with (unstable) nodes with build numbers as high as 663. Are you also seeing your problem with the stable builds? Sorry for the typo... that should say 661. Also tried it tonight with 556: no successful announcements, same types of exceptions I included before. I don't know if this is significant, but in the last couple of month my fresly bootsrapped node (now stable 552) has no traffic until I do some retrieve with fproxy; then it begin to have traffic that stabilize in a couple of hours. HTH. Marco -- + il Progetto Freenet - segui il coniglio bianco+ * the Freenet Project - follow the white rabbit* * Marco A. Calamari[EMAIL PROTECTED] www.marcoc.it * * PGP RSA: ED84 3839 6C4D 3FFE 389F 209E 3128 5698 * + DSS/DH: 8F3E 5BAE 906F B416 9242 1C10 8661 24A9 BFCE 822B + ___ Support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org:8080/mailman/listinfo/support -- + il Progetto Freenet - segui il coniglio bianco+ * the Freenet Project - follow the white rabbit* * Marco A. Calamari[EMAIL PROTECTED] www.marcoc.it* * PGP RSA: ED84 3839 6C4D 3FFE 389F 209E 3128 5698 * + DSS/DH: 8F3E 5BAE 906F B416 9242 1C10 8661 24A9 BFCE 822B + ___ Support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org:8080/mailman/listinfo/support
FW: [freenet-support] Announcement problem
Mrgh.. The listserv sets the wrong reply to address in the mails from this list. Here comes a mail I thought I sent to the list two hours ago.. /N -Original Message- From: Niklas Bergh [mailto:[EMAIL PROTECTED]] Sent: den 11 februari 2003 13:01 To: 'bdonlan' Subject: RE: [freenet-support] Announcement problem This is the last part of a debug-level log from one of my nodes that are idle without reason (One that is idle from startup that is.. Not one of those becoming idle after a number of days).. I can't really find a reason for the problems from it. If someone is interested in looking then help yourself ;) /N idle66nodeLog.zip Description: Zip compressed data
FW: Longtime idle connections, was: [freenet-support] Build 659 (unstable)
And another one -Original Message- From: Niklas Bergh [mailto:[EMAIL PROTECTED]] Sent: den 11 februari 2003 12:57 To: 'Matthew Toseland' Subject: RE: Longtime idle connections, was: [freenet-support] Build 659 (unstable) On this particular node maxmimumThreads are set to 300 so everything is order from that aspect... /N ___ Support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org:8080/mailman/listinfo/support
RE: [freenet-support] Build 659 (unstable)
659 seems to have solved the 'Node suddenly ceases traffic'-problem. I have a node that has been up for close 120 hours now and there is till no sign of stagnation. It is serving up 13000 q/h at about 1MBit/s. One thing though: Peer addr Send Count Send Size Receiving Messages Idle time Lifetime Thread Type ID 155.239.180.179:34467 0 0 yes 1 0 393188783 QThread-12740 Inbound 33c0b6 80.134.237.85:21321 0 0 yes 2 0 353667846 QThread-25929 Inbound 7e5c44 80.134.237.85:15291 0 0 yes 8 0 305199082 QThread-34344 Inbound 5e833f 68.82.148.48:18230 0 0 yes 1 0 27095 QThread-36576 Inbound 514847 213.208.127.216:17565 0 0 yes 7 0 172335455 QThread-44615 Inbound 134183 64.252.121.1:34381 0 0 yes 10 0 22933808 QThread-45372 Inbound 323c46 216.15.192.235:56589 0 0 yes 2 0 42376945 QThread-42938 Inbound 13374f 134.193.75.29:3277 0 0 yes 8 0 18536034 QThread-45215 Inbound 1423d4 129.240.200.147:39076 1 147772 yes 471 0 19078844 QThread-45337 Inbound 3c54ad This is the initial entries of my ocm table. I do not like that idle-time always is zero on those connections where 'receiving' is 'yes'. It seems like the idletime is set to zero even if the connection is idle. Should it really be so, couldn't idle-time be set to indicate the time since the last packet was recieved on that connection instead?! /N ___ Support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org:8080/mailman/listinfo/support
[freenet-support] Announcement problem
I just noticed that another of my nodes has suddenly stopped being useful. No connections in or out at all currently. Last part of the log: Feb 8, 2003 8:09:10 AM (freenet.node.states.announcing.Announcing, QThread-1818): Found 2 announcement targets for this node. Feb 8, 2003 8:09:32 AM (freenet.node.states.announcing.Announcing, QThread-1818): Announcement failed to d5f6 fcf4 4f77 7b5f dc91 bb7e a31d 0b99 7ddd 2ddf at depth 2. Feb 8, 2003 8:09:32 AM (freenet.node.states.announcing.Announcing, QThread-1818): Announcement failed to 6706 2742 3589 759e 1187 dbe9 66fb 98b0 93f6 0d02 at depth 2. Feb 8, 2003 8:24:10 AM (freenet.node.states.announcing.Announcing, QThread-1818): Found 2 announcement targets for this node. Feb 8, 2003 8:24:33 AM (freenet.node.states.announcing.Announcing, QThread-1818): Announcement failed to 319c 4799 819e 790f 3bfc f665 e7de 04b1 e585 1fb2 at depth 2. Feb 8, 2003 8:24:38 AM (freenet.node.states.announcing.NewInitialRequest, QThread-1818): Scheduling post-announcement request on chain 275cd702bbfd270a, for key e34207fc8075e7d481e816b24cdf747e8e9db21d0f0203 Feb 8, 2003 8:24:38 AM (freenet.node.states.announcing.Announcing, QThread-1818): Announced node successfully to 95c1 dee1 b574 a378 6d94 a35c 02dc 7049 66f3 4c8b at depth 2. Feb 8, 2003 8:39:10 AM (freenet.node.states.announcing.Announcing, QThread-1803): Found 1 announcement targets for this node. Feb 8, 2003 8:39:30 AM (freenet.node.states.announcing.Announcing, QThread-1803): Announcement failed to 3d45 c09b 2617 813c 8d7b 994e 970f a2c5 517c 6f6d at depth 3. Feb 8, 2003 8:54:10 AM (freenet.node.states.announcing.Announcing, QThread-1803): Found 1 announcement targets for this node. Feb 8, 2003 8:54:11 AM (freenet.node.states.announcing.Announcing, QThread-1803): Announcement failed to 993f acca cc9a 9911 bb44 034b b74d a422 0072 7210 at depth 2. Feb 8, 2003 9:09:10 AM (freenet.node.states.announcing.Announcing, QThread-1803): Found 1 announcement targets for this node. Feb 8, 2003 9:09:13 AM (freenet.node.states.announcing.Announcing, QThread-1803): Announcement failed to 348a 08a4 51cd 6978 af9e 7b08 ece1 b28e e7ae 8dbf at depth 2. It is one of my 554 nodes /N ___ Support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org:8080/mailman/listinfo/support
[freenet-support] Connection attemtpts counter error
Node version 660.. 6/4 successful (it was 3/1 right before)? tcp/138.88.84.46:164411.0 none 4 6 (150%) 9 secs. ago 552 1 0 no ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support
[freenet-support] Why would my node to this?
Feb 7, 2003 12:07:42 PM (freenet.support.SimpleDataObjectStore, QThread-486): Trying to write to c:\rtnodes_14166a Feb 7, 2003 12:07:42 PM (freenet.support.SimpleDataObjectStore, QThread-486): Trying to write to c:\rtprops_14166b Version 660 /N ___ support mailing list [EMAIL PROTECTED] http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support