RE: [freenet-support] 5098 Errors sendingPacket == null!

2004-10-24 Thread Niklas Bergh
Actually, it seems to have started getting better now.. I haven't seen any
of those messages for a while in the log.

/N

-Original Message-
From: [EMAIL PROTECTED]
[mailto:[EMAIL PROTECTED] On Behalf Of Toad
Sent: den 23 oktober 2004 13:25
To: [EMAIL PROTECTED]
Subject: Re: [freenet-support] 5098 Errors sendingPacket == null!

Argh. As usual it doesn't happen for me, so I can't fix it :

On Sat, Oct 23, 2004 at 10:28:25AM +0200, Niklas wrote:
 Similar issue here..
 
 /N
 
 -Original Message-
 From: [EMAIL PROTECTED]
 [mailto:[EMAIL PROTECTED] On Behalf Of Wayne McDougall
 Sent: den 23 oktober 2004 08:59
 To: [EMAIL PROTECTED]
 Subject: [freenet-support] 5098 Errors sendingPacket == null!
 
 Running 5098 on Windows XP SP2 768 Mb RAM
 
 More information available on request. The node is non-responsive. From
 Recent
 Logs
 
 19:47:04  jobDone(160,true) on [EMAIL PROTECTED] but
 sendingPacket == null!-
 19:48:52  resetting   -
 19:48:52  jobDone(160,true) on [EMAIL PROTECTED]
 but
 sendingPacket == null!-
 19:48:57  Failed to send packet, no more conns, No open connections
 and no way to
 contact node: DISCARDING
 [EMAIL PROTECTED]@[EMAIL PROTECTED]
 (null,null): outbound attempts=0:0/0:freenet.Message: beee48: DataChunk

@a3c1cfa4a430cdae:null:[EMAIL PROTECTED]:tru
 e,
 prio=1, expiryTime=1098514437842(-30 ms ago) on
 [EMAIL PROTECTED]
 (null,null): outbound attempts=0:0/0  -
 19:49:03  jobDone(160,true) on [EMAIL PROTECTED] but
 sendingPacket == null!-
 19:49:18  Consecutive same winner:
 [EMAIL PROTECTED]:
 timeToSendWindow=0, [EMAIL PROTECTED] (DSA(296b 4c9c 8e19
ef59
 f21c
 c003 36a6 3027 3b86 d9c2),tcp/romper.dyndns.org:26243, sessions=1,
 presentations=3, ID=DSA(296b 4c9c 8e19 ef59 f21c c003 36a6 3027 3b86
d9c2),
 version=Fred,0.5,STABLE-1.51,5098): outbound attempts=1:0/1 on
 [EMAIL PROTECTED]: id=7668f1c687d0a1f9,
 expiresAt=1098514218352 (59570 ms),
 [EMAIL PROTECTED]
 DataRequest @null @ 7668f1c687d0a1f9,

[EMAIL PROTECTED]@7668f1c687d0a1f9,t
 rue@
 -1:1098514158352:false:null:[EMAIL PROTECTED] DataRequest
 @null
 @ 7668f1c687d0a1f9, sendTimeout=17720,
 [EMAIL PROTECTED]
 (ea8568751ef624ead2e446baf8ce0a95852586580f0203,request),
 EstimateList=freenet.node.rt.ForgettingEstimateList: length=106, at=0,
 noConnCount=0, backedOffCount=4 4 times   -
 19:49:18  Consecutive same winner:
 [EMAIL PROTECTED]:
 timeToSendWindow=0, [EMAIL PROTECTED] (DSA(296b 4c9c 8e19
ef59
 f21c
 c003 36a6 3027 3b86 d9c2),tcp/romper.dyndns.org:26243, sessions=1,
 presentations=3, ID=DSA(296b 4c9c 8e19 ef59 f21c c003 36a6 3027 3b86
d9c2),
 version=Fred,0.5,STABLE-1.51,5098): outbound attempts=1:0/1 on
 [EMAIL PROTECTED]: id=7668f1c687d0a1f9,
 expiresAt=1098514218352 (59570 ms),
 [EMAIL PROTECTED]
 DataRequest @null @ 7668f1c687d0a1f9,

[EMAIL PROTECTED]@7668f1c687d0a1f9,t
 rue@
 -1:1098514158352:false:null:[EMAIL PROTECTED] DataRequest
 @null
 @ 7668f1c687d0a1f9, sendTimeout=17720,
 [EMAIL PROTECTED]
 (ea8568751ef624ead2e446baf8ce0a95852586580f0203,request),
 EstimateList=freenet.node.rt.ForgettingEstimateList: length=106, at=0,
 noConnCount=0, backedOffCount=5 5 times
 
 Continues on like this
 
 The node itself has effectively stopped functioning.
 
 ___
 Support mailing list
 [EMAIL PROTECTED]
 http://news.gmane.org/gmane.network.freenet.support
 Unsubscribe at
 http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]
 
 ___
 Support mailing list
 [EMAIL PROTECTED]
 http://news.gmane.org/gmane.network.freenet.support
 Unsubscribe at
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]

-- 
Matthew J Toseland - [EMAIL PROTECTED]
Freenet Project Official Codemonkey - http://freenetproject.org/
ICTHUS - Nothing is impossible. Our Boss says so.

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] Re: 5098 Errors sendingPacket == null!

2004-10-24 Thread Niklas Bergh
Here is yet a new message from the log, quite common.. seems to come in
bursts:

Did not terminate [EMAIL PROTECTED]
(f6dd7956f46d3d344f81ba78e5edee7a628ac54d120302,insert),
EstimateList=freenet.node.rt.ForgettingEstimateList: length=199, at=0,
noConnCount=0, backedOffCount=0

/N

-Original Message-
From: [EMAIL PROTECTED]
[mailto:[EMAIL PROTECTED] On Behalf Of Wayne McDougall
Sent: den 24 oktober 2004 23:44
To: [EMAIL PROTECTED]
Subject: [freenet-support] Re: 5098 Errors sendingPacket == null!

Niklas Bergh [EMAIL PROTECTED] writes:

 Actually, it seems to have started getting better now.. I haven't seen any
 of those messages for a while in the log.

No better for me. Last one in the log was less than 2 hours ago.

9:01:13 AM (freenet.MuxConnectionHandler, Network writing thread, ERROR):
jobDone(160,true) on [EMAIL PROTECTED] but 
sendingPacket == null!

Consecutive same winner errors are now everywhere:

10:31:43Consecutive same winner:
[EMAIL PROTECTED]:
timeToSendWindow=0, [EMAIL PROTECTED] (DSA(7f3a 5eec db54 57ee
a534
8715 0928 d369 bf47 a9d0),tcp/iakin.poweruser.org:26828, sessions=1,
presentations=3, ID=DSA(7f3a 5eec db54 57ee a534 8715 0928 d369 bf47 a9d0),
version=Fred,0.5,STABLE-1.51,5098): outbound attempts=5:0/5 on
[EMAIL PROTECTED]: id=65a8258c50575a40,
expiresAt=1098653506249 (2379 ms),
[EMAIL PROTECTED]
DataRequest @null @ 65a8258c50575a40,
[EMAIL PROTECTED]@65a8258c50575a40,
[EMAIL PROTECTED]:1098653503249:false:null:[EMAIL PROTECTED] 
DataRequest @null
@ 65a8258c50575a40, sendTimeout=17720,
[EMAIL PROTECTED]
(601d992fd890b89d4bdb0f5ff5d84018c231a5440f0203,request),
EstimateList=freenet.node.rt.ForgettingEstimateList: length=76, at=0,
noConnCount=0, backedOffCount=11 11 times



___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] is there any documentation

2004-09-12 Thread Niklas Bergh
Well, the load section in the general information page really is the best documenation 
of how the load factor is calculated.

The load section of the general information page explains, both the formula for how 
the load is calculated, as well as what values that
your node currently puts on the different factors that are included in the formula.

/N

On Sun, September 12, 2004 23:47, UltraRed said:
 that explains what the load status means on the freenet web interface?

 also, who do i interpret the other data under load on the general information page 
 as well as the other pages?

 thanks.

 UltraRed___
 Support mailing list
 [EMAIL PROTECTED]
 http://news.gmane.org/gmane.network.freenet.support
 Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]


___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] freenet.conf empty

2004-09-12 Thread Niklas Bergh
Try running the freenet jar with a '--config' parameter. This should allow you to 
create a new freenet.conf file.

On Mon, September 13, 2004 1:20, daniele said:
 Hi!
 I installed java, and run sh start-freenet.sh. I can use the interface,
 and i can also browse something. BUT, my freenet.conf file contains only
 2 lines, and no conf questions where asked when at start-up. I remember
 I had the same problem when some months ago I tryed to install freenet,
 but I don't remember the solution
 Anyway, the output:

 localhost:/hdb/.freenet# sh start-freenet.sh
 Detected freenet-ext.jar
 Detected freenet.jar
 Sun java detected.
 Sun Java 1.4.2 detected.
 Starting Freenet now: Command line: java -Xmx128m
 -XX:MaxDirectMemorySize=128m freenet.node.Main
 Done
 localhost:/hdb/.freenet# INFO: Native CPUID library
 'freenet/support/CPUInformation/libjcpuid-x86-linux.so' loaded from resource
 INFO: Optimized native BigInteger library
 'net/i2p/util/libjbigi-linux-pentium3.so' loaded from resource

 ___
 Support mailing list
 [EMAIL PROTECTED]
 http://news.gmane.org/gmane.network.freenet.support
 Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]



___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] Is this a problem?

2004-09-01 Thread Niklas Bergh
Believe me.. I have tried. The probable cause is that something somewhere
forgets to close a file it is holding... I haven't managed to find out
eactly what code it is though.

/N

Hmm. Since they don't happen on windows, they don't get debugged..
Unless you want to have a crack at them Iakin?

On Sun, Aug 29, 2004 at 02:01:56PM +0200, Niklas Bergh wrote:
 Yes probably.. But they have been around forever, at least for windows
 users?

 /N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] Is this a problem?

2004-08-29 Thread Niklas Bergh
Yes probably.. But they have been around forever, at least for windows
users?

/N

 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of Plonk
 Sent: den 27 augusti 2004 22:57
 To: [EMAIL PROTECTED]
 Subject: [freenet-support] Is this a problem?
 
 
 I get lots of these in my log:
 
 Delete failed on bucket t356f9930
 
 Is this something I should be worried about?
 
 ___
 Support mailing list
 [EMAIL PROTECTED] 
 http://news.gmane.org/gmane.network.freenet.su pport
 
 Unsubscribe at 
 http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]
 

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] Virus found in Freenet Update

2004-08-27 Thread Niklas Bergh
Says downloader.OG is Windows-specific. This suggests it can't possibly
have infected a JAR file. Okay, WHICH FILE did it report was infected?

[12:16] osh I'm still curious about this downloader-og that my antivirus
claims that nodeconfig.exe contains. Is my AV fscked up or is something
else a bit fishy?


cheers
/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] OS X Problems

2004-08-24 Thread Niklas Bergh
What about the logs?

/N

 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of Noah 
 Silverman
 Sent: den 24 augusti 2004 07:49
 To: [EMAIL PROTECTED]
 Subject: Re: [freenet-support] OS X Problems
 
 
 Only in the browser window.  The terminal session where I 
 start freenet 
 seems fine.
 
 Below is a typical start...
 
 sh start-freenet.sh
 Detected freenet-ext.jar
 Detected freenet.jar
 Sun java detected.
 Sun Java 1.4.2 detected.
 Starting Freenet now: Command line: java -Xmx128m 
 freenet.node.Main Done G4-17:~/Desktop/freenet noah$ INFO: 
 Native CPUID library jcpuid not 
 loaded, reason: 'Dont know jcpuid library name for os type 
 'Mac OS X'' - 
 will not be able to read CPU information using CPUID
 INFO: Native BigInteger library jbigi not loaded, reason: 'Dont know 
 jbigi library name for os type 'Mac OS X'' - using pure java
 
 
 
 
 
 Niklas Bergh wrote:
 
  - Original Message -
  From: Noah Silverman [EMAIL PROTECTED]
  To: [EMAIL PROTECTED]
  Sent: Tuesday, August 24, 2004 4:22 AM
  Subject: [freenet-support] OS X Problems
  
  
  
 Hi,
 
 I was able to download the latest package.
 
 For some reason, it won't run unless I comment out the line about:
 JAVA_ARGS=-XX:MaxDirectMemorySize=128m $JAVA_ARGS
 
 Once that is done, I can start freenet.
  
  
  Do you get any type of error message?
  
  /N
  ___
  Support mailing list
  [EMAIL PROTECTED] 
  http://news.gmane.org/gmane.network.freenet.support
  Unsubscribe at 
  http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
  Or mailto:[EMAIL PROTECTED]
  
 ___
 Support mailing list
 [EMAIL PROTECTED] 
 http://news.gmane.org/gmane.network.freenet.su pport
 
 Unsubscribe at 
 http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]
 

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] OS X Problems

2004-08-23 Thread Niklas Bergh

- Original Message - 
From: Noah Silverman [EMAIL PROTECTED]
To: [EMAIL PROTECTED]
Sent: Tuesday, August 24, 2004 4:22 AM
Subject: [freenet-support] OS X Problems


 Hi,
 
 I was able to download the latest package.
 
 For some reason, it won't run unless I comment out the line about: 
 JAVA_ARGS=-XX:MaxDirectMemorySize=128m $JAVA_ARGS
 
 Once that is done, I can start freenet.

Do you get any type of error message?

/N
___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] Re: Freenet causing crashes...

2004-08-18 Thread Niklas Bergh


 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of Mika Hirvonen
 Sent: den 18 augusti 2004 15:01
 To: [EMAIL PROTECTED]
 Subject: [freenet-support] Re: Freenet causing crashes...
 
 
 Don Gregory writes:
 
  I just recently setup a node, and I'm trying to let it run 
 for a while 
  to give it a chance to spread its tendrils so to speak.  I'm at the 
  point now where it's had maybe 4-5 hours to run over my 3Mb cable 
  connection and I'm STARTING to get a little responsiveness from the 
  network.
  
  Problem is, I want to leave it running for several hours to fully 
  propagate itself, whatever, but it seems to be gobbling up a LOT of 
  CPU power.  Well, not the Freenet executable, but the java engine 
  running
 
 The freenet.exe is just the system tray application, not 
 Freenet itself.
 
  it.  That by itself wouldn't be a problem, but it seems to 
 be making 
  my computer crash.  After leaving it running for 15 minutes 
 or so, my 
  computer will spontaneously crash/shut-down.
 
 Sounds like that your CPU is overheating.
 
  I tried setting the CPU priority in the config tool to be below 
  normal, I tried setting the process priority in Task Manager to be 
  below normal for both the javaw.exe and freenet.exe processes, but 
  it's still devouring over 90% of my CPU on average, and it's still 
  crashing my
 
 Programs with low priorities still can consume most of the 
 CPU time, if 
 there are no other CPU-intensive programs running.

Also try setting the JavaMem parameter in the FLaunch.ini file to
something like '192M' or '256M' instead of whatever it is set to right
now.

Cheers
/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] Re: My 5091 is dead (after 7 hours)

2004-08-13 Thread Niklas Bergh
Do you have a log message stating something like 'No addresses found!'
before those messages?

Also try setting:
logLevelDetail=freenet.node.IPAddressDetector:debug
in the conf/ini file (dont forget to remove the leading %-sign if you use
the one already in there)

Then tell me what the log says right before the first of those
NullPointerExceptions.

cheers
/N

- Original Message - 
From: Sam [EMAIL PROTECTED]
To: [EMAIL PROTECTED]
Sent: Thursday, August 12, 2004 6:35 AM
Subject: [freenet-support] Re: My 5091 is dead (after 7 hours)


 Niklas Bergh [EMAIL PROTECTED] writes:

 
  Any error messages in the log? I recommend that you upgrade your node to
  a v5091.. Which solves an issue wrt merging a new seednodes file
  (reseeding).
 
  Cheers
  /N
 

 When I try to reply to Niklas' post, Gmane tells me I'm top posting.  So
I'll
 write down here.

 I installed 5091, still no connections, no action, no nada.
 Exited and restarted freenet.  Freenet.log shows null pointer exceptions:

 INFO: Native CPUID library
 'freenet/support/CPUInformation/jcpuid-x86-windows.dll' loaded from
resource
 INFO: Optimized native BigInteger library
 'net/i2p/util/jbigi-windows-pentium4.dll' loaded from resource
 Aug 11, 2004 10:01:36 PM (freenet.node.states.maintenance.Checkpoint,
YThread-4,
 ERROR): unhandled throwable in Checkpoint: Autodetection of IP addresses:
 java.lang.NullPointerException
 java.lang.NullPointerException
 at freenet.node.IPAddressDetector.checkpoint
 (IPAddressDetector.java:171)
 at freenet.node.IPAddressDetector.checkpoint
 freenet.node.states.maintenance.Checkpoint.checkpoint(Checkpoint.java:54)
 at freenet.node.states.maintenance.Checkpoint.received
 (Checkpoint.java:47)
 at freenet.node.StateChain.received(StateChain.java:177)
 at freenet.node.StateChain.received(StateChain.java:61)
 at freenet.node.StateChainManagingMessageHandler$ChainContainer.run
 (StateChainManagingMessageHandler.java:332)
 at freenet.node.StateChainManagingMessageHandler$ChainContainer.
 received
 (StateChainManagingMessageHandler.java:285)
 at freenet.node.StateChainManagingMessageHandler$ChainContainer.access$100
 (StateChainManagingMessageHandler.java:204)
 at freenet.node.StateChainManagingMessageHandler.handle
 (StateChainManagingMessageHandler.java:96)
 at freenet.Ticker$Event.run(Ticker.java:323)
 at freenet.thread.YThreadFactory$YThread.run(YThreadFactory.java:285)
 Aug 11, 2004 10:09:27 PM (freenet.node.states.maintenance.
 Checkpoint, YThread-4,
 ERROR): unhandled throwable in Checkpoint: Autodetection of IP addresses:
 java.lang.NullPointerException
 java.lang.NullPointerException
 at freenet.node.IPAddressDetector.checkpoint
 (IPAddressDetector.java:171)
 at freenet.node.IPAddressDetector.checkpoint
 freenet.node.states.maintenance.Checkpoint.checkpoint
 (Checkpoint.java:54)
 at freenet.node.states.maintenance.Checkpoint.received
 (Checkpoint.java:47)
 at freenet.node.StateChain.received(StateChain.java:177)
 at freenet.node.StateChain.received(StateChain.java:61)
 at
 freenet.node.StateChainManagingMessageHandler$ChainContainer.run
 (StateChainManagingMessageHandler.java:332)
 at
 freenet.node.StateChainManagingMessageHandler$ChainContainer.received
 (StateChainManagingMessageHandler.java:285)
 at
 freenet.node.StateChainManagingMessageHandler$ChainContainer.access$100
 (StateChainManagingMessageHandler.java:204)
 at freenet.node.StateChainManagingMessageHandler.handle
 (StateChainManagingMessageHandler.java:96)
 at freenet.Ticker$Event.run(Ticker.java:323)
 at freenet.thread.YThreadFactory$YThread.run
 (YThreadFactory.java:285)
 Aug 11, 2004 10:58:38 PM (freenet.node.states.maintenance.Checkpoint,
YThread-0,
 ERROR): unhandled throwable in Checkpoint: Autodetection of IP addresses:
 java.lang.NullPointerException
 java.lang.NullPointerException
 at freenet.node.IPAddressDetector.checkpoint(IPAddressDetector.java:171)
 at freenet.node.IPAddressDetector.checkpoint(IPAddressDetector.java:87)
 at freenet.node.states.maintenance.Checkpoint.checkpoint
 (Checkpoint.java:54)
 at freenet.node.states.maintenance.Checkpoint.received
 (Checkpoint.java:47)
 at freenet.node.StateChain.received(StateChain.java:177)
 at freenet.node.StateChain.received(StateChain.java:61)
 at freenet.node.StateChainManagingMessageHandler$ChainContainer.run
 (StateChainManagingMessageHandler.java:332)
 at freenet.node.StateChainManagingMessageHandler$ChainContainer.received
 (StateChainManagingMessageHandler.java:285)
 at freenet.node.StateChainManagingMessageHandler$ChainContainer.access$100
 (StateChainManagingMessageHandler.java:204)
 at freenet.node.StateChainManagingMessageHandler.handle
 (StateChainManagingMessageHandler.java:96)
 at freenet.Ticker$Event.run(Ticker.java:323)
 at freenet.thread.YThreadFactory$YThread.run(YThreadFactory.java:285)


 Any help would be appreciated.
 Sam

 ___
 Support mailing list
 [EMAIL PROTECTED]
 http://news.gmane.org/gmane.network.freenet.support

RE: [freenet-support] My 5091 is dead (after 7 hours)

2004-08-11 Thread Niklas Bergh
Any error messages in the log? I recommend that you upgrade your node to
a v5091.. Which solves an issue wrt merging a new seednodes file
(reseeding).

Cheers
/N

 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of Sam
 Sent: den 11 augusti 2004 13:37
 To: [EMAIL PROTECTED]
 Subject: [freenet-support] My 5091 is dead (after 7 hours)
 
 
 (I'm not complaining.  I'm just providing info in case anyone 
 wants it.)
 
 Windows XP Home
 1.8 GHz
 384 MB RAM
 
 Installed Build 5090 from Start menu, including new seednodes 
 file. Load was 5-10% at first. Frost and Spider have been 
 running for 6 hours. Now 7 hours later load is stable at 1%. 
 Memory usage (pages/second, disk queue length) is low.
 
 Open Connections:
 Connections open (Inbound/Outbound/Limit) 0 (0/0/132)
 Transfers active (Transmitting/Receiving) 0 (0/0)
 Data waiting to be transferredNone
 Total amount of data transferred  None
 Number of requests (sent/received)0/0
 
 Node Status Info:
 Uptime:   0 days,   7 hours,   9 minutes
 Current routingTime: 0ms.
 Pooled threads running jobs: 2 (1.1%)
 Pooled threads which are idle: 25
 Current estimated load for rate limiting: 10%.
 Load due to thread limit = 1.1%
 Load due to routingTime = 10% = 100ms / 1000ms = overloadLow 
 (100%) Load due to messageSendTimeRequest = 20% = 100ms / 
 500ms = overloadLow (100%) Load due to output bandwidth 
 limiting = 0% because outputBytes(0) = limit (5419007.856 ) = 
 
 outLimitCutoff (0.9) * outputBandwidthLimit (100352) * 60
 Load due to expected inbound transfers: 0% because: 3600.0 
 req/hr * 9.991E-5 (pTransfer) * 
 
 293454.0 bytes = 105643 bytes/hr expected from current 
 requests, but maxInputBytes/minute = 15912960 (set 
 
 input limit) * 60 * 1.1 = 1050255360 bytes/hr target
 Current estimated load for QueryRejecting: 1.1%. 
 
 Routing Table (at /nodestatus.html)
 Number of known routing nodes 263
 Number of node references 263
 Number of newbie nodes0
 Number of uncontactable nodes 263
 Contacted and attempted to contact node references0
 Contacted node references 0
 Contacted newbie node references  0
 Connections with Successful Transfers 0
 Backed off nodes  0
 Connection Attempts   0
 Successful Connections0
 Lowest max estimated search time  0ms
 Lowest max estimated DNF time 0ms
 Lowest global search time estimate30.0ms
 Highest global search time estimate   30.0ms
 Lowest global transfer rate estimate  0 bytes/second
 Highest global transfer rate estimate 0 bytes/second
 Lowest one hop probability of DNF 0.95
 Highest one hop probability of DNF0.95
 Lowest one hop probability of transfer failure0.95
 Highest one hop probability of transfer failure   0.95
 Single hop probability of QueryRejected   0.9
 Single hop average time for QueryRejected 17720.0
 Single hop probability of early timeout   0.9
 Single hop average time for early timeout 17720.0
 Single hop probability of search timeout  0.9
 Single hop average time for search timeout493544.0
 Single hop overall probability of DNF given no timeout0.9
 Single hop overall probability of transfer failure given 
 transfer  0.9
 Probability of transfer given incoming request0.1
 Total number of requests that didn't QR   0
 Total number of reqests that timed out before a QR or 
 Accepted  0
 Implementationfreenet.node.rt.NGRoutingTable
 
 Freenet.log (62 KB in error logging mode)
 The first few errors:
 INFO: Native CPUID library 
 'freenet/support/CPUInformation/jcpuid-x86-windows.dll' 
 loaded from resource
 INFO: Optimized native BigInteger library 
 'net/i2p/util/jbigi-windows-pentium4.dll' loaded from 
 resource Aug 10, 2004 11:18:00 PM 
 (freenet.client.http.FproxyServlet, YThread-30, ERROR): 
 Unexpected Exception in 
 
 FproxyServlet.doGet -- freenet.KeyException: Byte array does 
 not contain a SVK
 freenet.KeyException: Byte 
 
 array does not contain a SVK
   at freenet.keys.SVK.init(SVK.java:41)
   at freenet.keys.SVK.init(SVK.java:50)
   at freenet.client.ClientSVK.init(ClientSVK.java:53)
   at freenet.client.ClientSSK.init(ClientSSK.java:57)
   at 
 freenet.client.ClientSSK.createFromRequestURI(ClientSSK.java:44)
   at sun.reflect.GeneratedMethodAccessor2.invoke(Unknown Source)
   at 
 sun.reflect.DelegatingMethodAccessorImpl.invoke(Unknown Source)
   at java.lang.reflect.Method.invoke(Unknown Source)
   at freenet.client.AbstractClientKey.createClientKey
 (AbstractClientKey.java:49)
   at freenet.client.AbstractClientKey.createFromRequestURI
 (AbstractClientKey.java:36)
   at 
 freenet.client.http.FproxyServlet.doGet(FproxyServlet.java:570)
   at javax.servlet.http.HttpServlet.service(Unknown Source)
   at javax.servlet.http.HttpServlet.service(Unknown Source)
   at 
 

Re: [freenet-support] 5088 - New Build 5089 Doesn't Show On FProxy MainPage

2004-08-09 Thread Niklas Bergh
Nodes tells each other their respective version.. When enough nodes of a newer version 
has appeared on the network your node will indicate that there is a new build 
available.

/N

-- Original Message --
From: [EMAIL PROTECTED]
Reply-To: [EMAIL PROTECTED]
Date:  Thu, 05 Aug 2004 08:29:10 -0700

Since the 5089 announcement, I've been checking the FProxy main page for 
an indication that 5089 is available, but it doesn't show that it is 
available.  I have been able to upgrade to 5089, but I'm concerned that 
there are nodes out there that won't know that it's time to upgrade. 
How is the FProxy main page made aware up a new version?
___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] Re: FIX: Freenet thrashing the disk

2004-08-08 Thread Niklas Bergh
I think default is 64 megs in the latest Sun JVMs
/N
- Original Message - 
From: Jano [EMAIL PROTECTED]
To: [EMAIL PROTECTED]
Sent: Thursday, August 05, 2004 1:21 PM
Subject: [freenet-support] Re: FIX: Freenet thrashing the disk


 [EMAIL PROTECTED] wrote:
  woah, that's weird.  afaicr, default==192 

 I thought it was 128...

 
 
 Since 5088 my Windows XP has been thrashing the disk like nothing I'd
ever
 seen
 before. Memory load was high (440 Mb virtual on a 192 MB physical
machine)
 but
 not  extremely unusual. According to Task Manager Java and Freenet
weren't
 taking large amountas of memory.
 
 I put it down to being associated with general network issues.
 
 But with 5089 it was still a problem. My computer was virtually unusable
 and I
 don't think my node was performign well.
 
 I wasn't getting any error messages about out of memory (although
 periodically
 Windows would advise that my Virtual memory was too low and increase
it).
 The
 node was working, but like the whole computer was very slow, and the
disk
 was
 going all the time.
 
 THE SOLUTION:
 
 In the file flaunch.ini (located in \program files\freenet ) I changed
the
 line
 
 JavaMem=default
 
 to become:
 JavaMem=192
 
 Rebooted and restarted Freenet and now my node is working the best I've
 ever
 seen and the disk thrashing has stopped.
 
 I don't know if 192 is a good choice.
 
 I don't know why default became bad - too many node references?
 Crassoing some
 threshold? I did increase by datastore size a week earlier...or was it
the
 BigInteger(?) optimisations introduced in 5088?
 
 I'm posting this in case anyone else finds it useful, and also so that
if
 someone has a chance to think about what default means in flaunch.ini
it
 sure
 wasn't a good choice for me.
 
 
 
 ___
 Support mailing list
 [EMAIL PROTECTED]
 http://news.gmane.org/gmane.network.freenet.support
 Unsubscribe at
 http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]
 
 
 
 
  ___
  Support mailing list
  [EMAIL PROTECTED]
  http://news.gmane.org/gmane.network.freenet.support
  Unsubscribe at
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
  Or mailto:[EMAIL PROTECTED]
 

 ___
 Support mailing list
 [EMAIL PROTECTED]
 http://news.gmane.org/gmane.network.freenet.support
 Unsubscribe at
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]


___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] FYI: Build 5087 Error message

2004-07-28 Thread Niklas Bergh
For gods sake, you are the _third_ person to report this. Read the other
messages for a description of the cause. It is being worked on.

This particular issue has nothing to do with the CPU usage though..

 tail freenetERROR: The resource freenet/support/CPUInfo 
 mation/libjcpuid-x86-linux.so was not a valid library for 
 this platform
 java.lang.UnsatisfiedLinkError: /tmp/jcpuid15030lib.tmp: 
 libgcc_s.so.1: cannot pen shared object file: No such file or 
 directory
 at java.lang.ClassLoader$NativeLibrary.load(Native Method)
 at java.lang.ClassLoader.loadLibrary0(ClassLoader.java:1560)
 at java.lang.ClassLoader.loadLibrary(ClassLoader.java:1456)
 at java.lang.Runtime.load0(Runtime.java:737)
 at java.lang.System.load(System.java:811)
 at 
 freenet.support.CPUInformation.CPUID.loadFromResource(CPUID.java:460
 
 at 
 freenet.support.CPUInformation.CPUID.loadNative(CPUID.java:392)
 at 
 freenet.support.CPUInformation.CPUID.clinit(CPUID.java:32)
 at 
 net.i2p.util.NativeBigInteger.resolveCPUType(NativeBigInteger.java:1
 2)
 at 
 net.i2p.util.NativeBigInteger.clinit(NativeBigInteger.java:113)
 at freenet.crypt.Util.clinit(Util.java:89)
 at freenet.crypt.Yarrow.accumulator_init(Yarrow.java:268)
 
 _
 Get Paid to Surf the Web! 
 http://www.alladvantage.com/home.asp? refid=AVZ855
 
 ___
 
 Support mailing list
 [EMAIL PROTECTED] 
 http://news.gmane.org/gmane.network.freenet.su pport
 
 Unsubscribe at 
 http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]
 

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] CPU pegging at 100% since 5085

2004-07-27 Thread Niklas Bergh



Could you produce a full stackdump when the node is 
using 100% of the CPU

Is the node close to the configured memory limit 
(-Xmx)when it is using 150MB?

cheers
/N

  - Original Message - 
  From: 
  Mike Z 
  To: [EMAIL PROTECTED] 
  Sent: Tuesday, July 27, 2004 2:57 
AM
  Subject: [freenet-support] CPU pegging at 
  100% since 5085
  Since upgrading to 5085 (and 5086), Freenet is using up a huge 
  amount of processor time, to the point where the web interface no longer even 
  responds. This doesn't happen every start, but once it occurs, freenet has to 
  be killed and restarted. It sometimes happens when first started, sometimes 
  after running for a while.The machine is running Win XP, with a 3.2Ghz 
  P4 with HT, and 1GB of RAM. Both processor threads are pegged at full 
  utilization, and freenet is holding steady at about 150MB of RAM used. 
  Any help would be appreciated.Uptime:  0 days,  1 
  hour,  51 minutes Current routingTime: 0ms. Pooled threads 
  running jobs: 272   (54.4%)  
  [Rejecting incoming connections and requests!] Pooled 
  threads which are idle: 10It's normal for the node to sometimes reject 
  connections or requests for a limited period. If you're seeing rejections 
  continuously the node is overloaded or something is wrong (i.e. a bug). 
  Current estimated load for rate limiting: 452.2%. Load due to thread limit 
  = 54.4%Load due to routingTime = 10% = 100ms / 1000ms = overloadLow 
  (80%)Load due to messageSendTimeRequest = 452.2% = 4522ms / 1000ms  
  overloadLow (80%)Load due to output bandwidth limiting = 14.6% because 
  outputBytes(215153) = limit (1474560 ) = outLimitCutoff (2) * 
  outputBandwidthLimit (12288) * 60Load due to expected inbound transfers: 
  2.4% because: 404.76961565213924 req/hr * 0.030716723549488085 (pTransfer) * 
  377327.0 bytes = 4691380 bytes/hr expected from current requests, but 
  maxInputBytes/minute = 2949120 (output limit assumed smaller than input 
  capacity) * 60 * 1.1 = 194641920 bytes/hr targetCurrent estimated load for 
  QueryRejecting: 55.4%. 
  
  

  ___Support mailing 
  list[EMAIL PROTECTED]http://news.gmane.org/gmane.network.freenet.supportUnsubscribe 
  at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/supportOr 
  mailto:[EMAIL PROTECTED]
___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]

Re: [freenet-support] Connection bug in recent builds

2004-07-25 Thread Niklas Bergh
Hmm..I am not so sure about that.. I am also seeing _load_ of those messages
recently.

If there is a crypto error then the link will probably be corrupted, right?
So.. the peer cannot for sure know when it cannot expect more data to
arrive.. But.. this is just a theory.. I haven't inspected the code for the
truth.

/N
- Original Message - 
From: Marc [EMAIL PROTECTED]
To: [EMAIL PROTECTED]
Sent: Sunday, July 25, 2004 12:14 PM
Subject: Re: [freenet-support] Connection bug in recent builds


 Hi toad, you wrote
  Recent builds, both stable and unstable, have a bug that causes
  connections to fail with crypto related errors. This is probably not due
  to NativeBigInteger, as it happens on stable, which doesn't have NBI.
  Iakin has produced it reliably, although most nodes seem to work anyway.
  It can be reliably reproduced on a local test network. I have made some
  progress (an identity appears to be corrupted somehow), but I haven't
  finished yet. I will fix it on Monday.

 Do these errors include the following? This doesn't look crypto related.

 25.07.2004 11:40:14 (freenet.support.io.NIOInputStream, YThread-2822,
NORMAL): waited more than 12ms in NIOIS.read() tcp/connection:
8481127.0.0.1:36693,[EMAIL PROTECTED]:freenet.support
[EMAIL PROTECTED] closing
 java.lang.Exception: debug
 at freenet.support.io.NIOInputStream.read(NIOInputStream.java:302)
 at
freenet.interfaces.FreenetConnectionRunner.handle(FreenetConnectionRunner.ja
va:81)
 at
freenet.interfaces.LocalNIOInterface$ConnectionShell.run(LocalNIOInterface.j
ava:268)
 at
freenet.thread.YThreadFactory$YThread.run(YThreadFactory.java:285)

 I used ethereal, but forgot to save. So from memory this is what
 happens: Frost sends a ClientHello message, but gets no answer and after
 2 minutes, fred resets the connection.

 Adiaux
   Marc
 ___
 Support mailing list
 [EMAIL PROTECTED]
 http://news.gmane.org/gmane.network.freenet.support
 Unsubscribe at
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]


___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] NPEs and other exceptions with 5085

2004-07-23 Thread Niklas Bergh
 There is also 
 a typo in MuxConnectionHandler.java: 'utbound' rather than 'outbound'.

Fixed now :)

/N 

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] Load

2004-07-20 Thread Niklas Bergh


 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of 
 Zenon Panoussis
 Sent: den 20 juli 2004 05:15
 To: [EMAIL PROTECTED]
 Subject: Re: [freenet-support] Load
 
 
 
 I wrote:
 
  Taking what you say here for granted, the entire discussion 
 up to this 
  point is probably a meaningless exchange based on some 
  misunderstanding on my part. But what?
 
  [URIs from logs]
 
  Would be interested to see some of this list.
 
  Duh. So am I by now, but with all the messing around today
  I deleted them. I can try again though.
 
 Now I know what the misunderstanding was. The working URIs
 I found in my logs come from the default bookmarks in the 
 interface servlet. I had never visited them before, but they 
 had passed my client anyway.

Yes, the node tries to preload them when it starts.

Cheers
/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] What are distribution servlets used for?

2004-07-11 Thread Niklas Bergh
Please check freenet.log for any error messages.

/N

- Original Message - 
From: Weiliang Zhang [EMAIL PROTECTED]
To: [EMAIL PROTECTED]
Sent: Sunday, July 11, 2004 3:00 PM
Subject: Re: [freenet-support] What are distribution servlets used for?


 Florian Streck wrote:
  On Sun, Jul 11, 2004 at 01:30:57PM +0100, Weiliang Zhang wrote:
 
 Saw the port 8891 in freenet.conf only today What are distribution
 servlets used for? My nodes seems to be running ok with this port
 firewalled.
 
 
  As it seems it is used for the Distribution Pages (click on the link
  Spread Freenet in the Web-Interface). This spreads a freenet-zip with
  your personal seednodes. So not all people start with the same
  seednodes. This should make the net better connected I think.

 I have activated the distribution port and the allowHosts is the
 default, i.e. everyone. However, when I clicked Spread Freenet I got a
 blank page with only one line that says: Error. Any ideas?

 
  If the port is firewalled it just means your Distribution pages can't be
  accessed once they are created. It has nothing to do with the running of
  your node.
 
  Florian
 


 -- 
 Best regards,
 Weiliang Zhang
 ___
 Support mailing list
 [EMAIL PROTECTED]
 http://news.gmane.org/gmane.network.freenet.support
 Unsubscribe at
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]


___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] Stable build 5083

2004-05-30 Thread Niklas Bergh
Reseed it. 5083 sets 5082 to mandatory and if you haven't run your node for
a while chance is that all the nodes in your old rt was older than 5082.

/N
- Original Message - 
From: Jonathan Towle [EMAIL PROTECTED]
To: Freenet [EMAIL PROTECTED]
Sent: Sunday, May 30, 2004 4:38 AM
Subject: RE: [freenet-support] Stable build 5083


 I hadn't started my rinky-dinky dialup transient node for a while, so I
 tried updating with 5083 and the latest seednodes.

 It correctly detects me as transient, but is unable to connect to any
other
 nodes.  I can see I'm sending syn packets to addresses, but I can't
 establish any connections.

 My setup: Win2K, 56K dialup, latest everything from Freenet.

 The log:

 May 29, 2004 10:17:21 PM (freenet.node.Main, main, NORMAL): Starting
Freenet
 (Fred) 0.5 node, build #5083 on JVM Sun Microsystems Inc.:Java HotSpot(TM)
 Client VM:1.4.2-b28
 May 29, 2004 10:17:23 PM (freenet.node.Main, main, NORMAL): loading node
 keys: node
 May 29, 2004 10:17:23 PM (freenet.node.Main, main, NORMAL): Read node file
 May 29, 2004 10:17:24 PM (freenet.node.Main, main, NORMAL): starting
 filesystem
 May 29, 2004 10:17:27 PM (freenet.node.Main, main, NORMAL): loading data
 store
 May 29, 2004 10:17:27 PM (freenet.node.Main, main, NORMAL): loading
routing
 table
 May 29, 2004 10:17:27 PM (freenet.node.Main, main, NORMAL): From output:
 49152.0
 May 29, 2004 10:17:27 PM (freenet.node.Main, main, NORMAL): Setting
default
 initTransferRate to 49152.0
 May 29, 2004 10:17:27 PM (freenet.node.rt.NGRoutingTable, main, NORMAL):
 Loading estimators
 May 29, 2004 10:17:28 PM (freenet.node.Main, main, NORMAL): Created new
NGRT
 May 29, 2004 10:17:28 PM (freenet.node.Main, main, NORMAL): Loaded stats
 May 29, 2004 10:17:28 PM (freenet.node.Main, main, NORMAL): loading temp
 bucket factory
 May 29, 2004 10:17:28 PM (freenet.node.Main, main, NORMAL): loaded temp
 bucket factory
 May 29, 2004 10:17:28 PM (freenet.node.Main, main, NORMAL): Loaded bucket
 factory
 May 29, 2004 10:17:29 PM (freenet.node.Main, main, NORMAL): read seed
nodes
 May 29, 2004 10:17:29 PM (freenet.node.Main, main, NORMAL): Initial refs
 count: 5
 May 29, 2004 10:17:29 PM (freenet.node.Main, main, NORMAL): not seeding
 routing table
 May 29, 2004 10:17:29 PM (freenet.node.Main, main, NORMAL): saved routing
 table
 May 29, 2004 10:17:29 PM (freenet.node.Main, main, NORMAL): starting node
 May 29, 2004 10:17:30 PM (freenet.node.Main, main, NORMAL): loading
service:
 mainport
 May 29, 2004 10:17:31 PM (freenet.node.Main, main, NORMAL): loading
service:
 distribution
 May 29, 2004 10:17:31 PM
 (freenet.interfaces.servlet.SingleHttpServletContainer, main, NORMAL):
 Loading the single servlet distribution.params.servlet
 May 29, 2004 10:17:31 PM (freenet.node.Node, main, NORMAL): Starting
 ticker..
 May 29, 2004 10:17:31 PM (freenet.node.Node, main, NORMAL): Starting
 interfaces..
 May 29, 2004 10:17:31 PM (freenet.node.http.BookmarkManagerServlet, main,
 NORMAL): Bookmarks updated on request
 May 29, 2004 10:17:32 PM (freenet.node.Node, main, NORMAL): starting
 ListenSelector..
 May 29, 2004 10:17:32 PM (freenet.node.Main, main, NORMAL): Not announcing
 because I am transient.
 May 29, 2004 10:17:37 PM (freenet.node.Main$InsertARK, YThread-2, NORMAL):
 RouteNotFound Inserting ARK
 May 29, 2004 10:17:42 PM (freenet.node.Main$InsertARK, YThread-5, NORMAL):
 RouteNotFound Inserting ARK
 May 29, 2004 10:17:47 PM (freenet.node.Main$InsertARK, YThread-3, NORMAL):
 RouteNotFound Inserting ARK
 May 29, 2004 10:17:53 PM (freenet.node.Main$InsertARK, YThread-8, NORMAL):
 RouteNotFound Inserting ARK
 May 29, 2004 10:17:58 PM (freenet.node.Main$InsertARK, YThread-8, NORMAL):
 RouteNotFound Inserting ARK
 May 29, 2004 10:18:03 PM (freenet.node.Main$InsertARK, YThread-6, NORMAL):
 RouteNotFound Inserting ARK
 May 29, 2004 10:18:09 PM (freenet.node.Main$InsertARK, YThread-3, NORMAL):
 RouteNotFound Inserting ARK
 May 29, 2004 10:18:14 PM (freenet.node.Main$InsertARK, YThread-0, NORMAL):
 RouteNotFound Inserting ARK
 May 29, 2004 10:18:19 PM (freenet.node.Main$InsertARK, YThread-9, NORMAL):
 RouteNotFound Inserting ARK
 May 29, 2004 10:18:24 PM (freenet.node.Main$InsertARK, YThread-4, NORMAL):
 RouteNotFound Inserting ARK
 May 29, 2004 10:18:29 PM (freenet.node.Main$InsertARK, YThread-4, NORMAL):
 RouteNotFound Inserting ARK
 May 29, 2004 10:18:34 PM (freenet.node.Main$InsertARK, YThread-6, NORMAL):
 RouteNotFound Inserting ARK
 May 29, 2004 10:18:39 PM (freenet.node.Main$InsertARK, YThread-3, NORMAL):
 RouteNotFound Inserting ARK
 May 29, 2004 10:18:44 PM (freenet.node.Main$InsertARK, YThread-2, NORMAL):
 RouteNotFound Inserting ARK
 May 29, 2004 10:18:49 PM (freenet.node.Main$InsertARK, YThread-9, NORMAL):
 RouteNotFound Inserting ARK

 -vinyl1



 ___
 Support mailing list
 [EMAIL PROTECTED]
 http://news.gmane.org/gmane.network.freenet.support
 Unsubscribe at

RE: [freenet-support] Re: Java Applet

2004-05-24 Thread Niklas Bergh
From the freenet.ini file:

# A comma-separated list of hosts that may connect to the FCP port
# (clientPort).  If left blank, only the localhost will be allowed. If
you set this, make sure localhost is included in the list or  access
won't be allowed from the local machine. 
# May be given as IP addresses or host names.
%fcpHosts=


 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of sally
 Sent: den 24 maj 2004 10:26
 To: [EMAIL PROTECTED]
 Subject: [freenet-support] Re: Java Applet
 
 
 Roger Oksanen [EMAIL PROTECTED] writes:
  The only limitation when creating a java applet is the sanbox the 
  applet
  is run in. By default the sanbox limits the applet from connecting 
  other hosts than the applet source host (e.g. the applet 
 server must be 
  running a freenet node accepting FCP connections from other hosts).
 
 Is it possible for a node to accept FCP connections from 
 other hosts?  I've read that you can only use FCP for clients 
 running on a machine hosting a node.  I also read somewhere 
 that there may be a crypto version of FCP coming out to allow 
 connections from other hosts.
 
 Ideally, we want a Java Applet running on a machine without a 
 node to be able to insert a file onto Freenet.  Is this 
 possible?  Any pointers from you would be greatly appreciated. 
 
 
 
 
 ___
 Support mailing list
 [EMAIL PROTECTED] 
 http://news.gmane.org/gmane.network.freenet.su pport
 
 Unsubscribe at 
 http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]
 

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] Freenet directory sharing between Linux/windoz

2004-05-19 Thread Niklas Bergh
Or adding code to handle the situation better even...

/N

 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of 
 Thomas Guyot-Sionnest
 Sent: den 19 maj 2004 05:57
 To: [EMAIL PROTECTED]
 Subject: Re: [freenet-support] Freenet directory sharing 
 between Linux/windoz
 
 
 TLD wrote:
  Roger Oksanen wrote:
  
 I'm guessing that freenet does a listing to decide if there exists a
 valid datastore. It would not be to efficient to open every 
 file just 
  
  
  Lame as it may sound, try disabling the index file for the 
 datastore.
  
  
 
 Thank for the tip! I'll try in the next days... If it works 
 maybe it's 
 worth adding a FAQ entry... doesn't it?
 
 
 Thank again all for your help, I'll follow-up in a few days.
 
 
 Thomas Guyot
 
 ___
 Support mailing list
 [EMAIL PROTECTED] 
 http://news.gmane.org/gmane.network.freenet.su pport
 
 Unsubscribe at 
 http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]
 

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] Re: Stable build 5082

2004-05-17 Thread Niklas Bergh
 How could that happen???
 It is the same problem you had in the unstable branch, isn't 
 it? So why did the modification, which have caused the 
 problem in unstable, 
 get into the code of the stable branch, before it was tested for a 
 longer period (at least a day or two) in the unstable 
 network? For what 
 are you running the unstable network?
 I DO NOT UNDERSTAND IT!

Hmmm.. Because noone noticed that the modification was buggy at the time
when it was committed (read last summer) maybe?

/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] 5078 (Stable) Just Sits There, Does Nothing

2004-05-13 Thread Niklas Bergh
Get them either by spawning the node with the '--help' parameter or by
having a look here:
http://localhost:/servlet/nodeinfo/documentation/cli

/N

 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of 
 Nicholas Sturm
 Sent: den 13 maj 2004 08:46
 To: [EMAIL PROTECTED]
 Subject: RE: [freenet-support] 5078 (Stable) Just Sits There, 
 Does Nothing
 
 
 
 
 
  [Original Message]
  From: Niklas Bergh [EMAIL PROTECTED]
  To: [EMAIL PROTECTED]
  Date: 5/12/2004 3:12:29 PM
  Subject: RE: [freenet-support] 5078 (Stable)  Just Sits There, Does
 Nothing
 
  Yes it has :)
 
 Where is the list in case I happen to want to use them?
 
 
 
 ___
 Support mailing list
 [EMAIL PROTECTED] 
 http://news.gmane.org/gmane.network.freenet.su pport
 
 Unsubscribe at 
 http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]
 

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] 5078 (Stable) Just Sits There, Does Nothing

2004-05-12 Thread Niklas Bergh
Hmmm.. Can it be so that you are using an unstable build (6xxx) along
with stable-network seednodes (5xxx) or the other way around?

/N

 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of [EMAIL PROTECTED]
 Sent: den 12 maj 2004 17:02
 To: [EMAIL PROTECTED]
 Subject: Re: [freenet-support] 5078 (Stable) Just Sits There, 
 Does Nothing
 
 
 At 02:21 PM 5/12/2004 +0100, you wrote:
 Okay.
 Show me the header (the lines at the top, before the table) 
 from http://127.0.0.1:/servlet/nodestatus/nodestatus.html
 
 If it says 0 node references, stop freenet, remove it, 
 reinstall it with new seednodes, and if it still doesn't 
 work, send me your freenet.log
 
 Number of known routing nodes 0
 Number of node references 0
 Number of newbie nodes0
 Number of uncontactable nodes 0
 Contacted and attempted to contact node references0
 Contacted node references 0
 Contacted newbie node references  0
 Connections with Successful Transfers 0
 Backed off nodes  0
 Connection Attempts   0
 Successful Connections0
 Lowest max estimated search time  0ms
 Lowest max estimated DNF time 0ms
 
 ...etc...
 
 And still the same after reinstalling (via the update 
 sanapshot feature) 
 and re-downloading the seednodes.ref.
 
 ___
 Support mailing list
 [EMAIL PROTECTED] 
 http://news.gmane.org/gmane.network.freenet.su pport
 
 Unsubscribe at 
 http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]
 

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] 5078 (Stable) Just Sits There, Does Nothing

2004-05-11 Thread Niklas Bergh
Is it running? Has it any connections open? Does it say something bad in
the log?

/N

 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of [EMAIL PROTECTED]
 Sent: den 11 maj 2004 06:12
 To: [EMAIL PROTECTED]
 Subject: [freenet-support] 5078 (Stable) Just Sits There, Does Nothing
 
 
 Windows XP Pro
 
 After  having Freenet disabled for a couple of weeks while I 
 was doing some 
 heavy downloading I decided to fire it up again.  I figured 
 it was a good 
 idea to update the snapshot from 5077 first.  Big mistake.  
 Now it does 
 nothing.  All I did was update the snapshot and download the new 
 seednodes.ref.  I haven't changed anything else with my configuration.
 
 What could be going wrong?
 
 ___
 Support mailing list
 [EMAIL PROTECTED] 
 http://news.gmane.org/gmane.network.freenet.su pport
 
 Unsubscribe at 
 http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]
 

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] I have block by Internet gateway!So I can not getthe lasted freenet version, can mail to me a windows version?

2004-05-06 Thread Niklas Bergh
Title: Message



Blocked from what? HTTP communication to www.frenetproject.org? If so.. then 
maybesomeone cancreate a distributionpage for 
you...

/N

  
  -Original Message-From: 
  [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] 
  On Behalf Of west boySent: den 6 maj 2004 
  03:46To: [EMAIL PROTECTED]Subject: 
  [freenet-support] I have block by Internet gateway!So I can not getthe lasted 
  freenet version, can mail to me a windows version?
  
  
  Do you Yahoo!?Win 
  a $20,000 Career Makeover at Yahoo! HotJobs 

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]

Re: [freenet-support] TO big LOG!

2004-04-30 Thread Niklas Bergh
gmane.org

/N

- Original Message - 
From: Edward Langenback [EMAIL PROTECTED]
To: Cameron GArnham [EMAIL PROTECTED]
Sent: Friday, April 30, 2004 10:13 PM
Subject: Re: [freenet-support] TO big LOG!


-BEGIN PGP SIGNED MESSAGE-
Hash: SHA1

On Friday, April 30, 2004 at 8:34:08 AM
in Message mid:[EMAIL PROTECTED], Cameron
wrote:


 System:

 AMD 1.4gz ; 256MB RAM
 OS debian testing
 KERNEL 2.6.3
 FREENET VER:  5077
 JAVA: ava version 1.5.0-beta
 Java(TM) 2 Runtime Environment, Standard Edition
 (build 1.5.0-beta-b32c)
 Java HotSpot(TM) Client VM (build 1.5.0-beta-b32c,
 mixed mode)

 currently the log is 5.7GB there MUST be a cap!.

 I dnot know much about this Hope that this helps.
 I will be glad to help a proviede more info but the
 F/N dir gets deleted.


unless i'm mistaken, I belive there are *nix scripts that handle
rotating log files... I've seen 'em posted on here before... is there
a list archive perhaps?

in Him,
 -Ed

- --
Note: If this email does not have a *VALID* PGP signature
you should contact me to verify the content.

PGP Key ID: 0xB9E76C70
- -=-=-=-=-=-=-=-=-=-=-=
*Christ is NOT Jesus' last name!*
- -=-=-=-=-=-=-=-=-=-=-=
Psalm 23 And The Days Of Our Lives
http://peculiar.wcw.net/days23.shtml

 / \
 \ /   Join the ASCII-Ribbon Campaign to Stamp Out HTML Email !
  X
 / \

-BEGIN PGP SIGNATURE-
Version: PGPsdk version 1.7.1 (C) 1997-1999 Network Associates, Inc. and its
affiliated companies.

iQA/AwUBQJKzV7cY6Vy552xwEQK7nQCg7E9Lm6kEXwnLU89s2Sot0NSRyCoAn2JW
TtavL4iPfEuurqcT2yDPkndy
=kGCD
-END PGP SIGNATURE-

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] Freenet crashes DSL modem

2004-04-30 Thread Niklas Bergh
You are not alone in this if would seem:
http://www.dslreports.com/forum/remark,8777483~mode=flat
Someone says:  'If you guys are still having problems with your Actiontec's.
Call into the Qwest DSL repair center and have them escalate it to the
Actiontec engineers. If that doesn't work, they will bring you a new GT 701
modem.'

/N

- Original Message - 
From: Galen [EMAIL PROTECTED]
To: [EMAIL PROTECTED]
Sent: Saturday, May 01, 2004 5:30 AM
Subject: [freenet-support] Freenet crashes DSL modem


 Hi,

 I've got an interesting arrangement here. It appears that when I run
 freenet, it crashes the DSL/NAT (combo device) actiontec DSL modem.
 Yes, it totally freezes, no data in or out (no pings, dhcp, etc) until
 physically reset.

 The arrangement is somewhat unusual, but I can reliably crash the
 modem. Every single time.

 Here's how the network layout:

 Qwest DSL Modem Actiontec w/NAT connected to a Netgear wireless
 router's LAN side, which creates a wireless network. Then, near the
 boundary of reception, there's a D-Link access point in client mode
 that's connected to the netgear wireless network. The ethernet cable
 from the client mode AP connects to the WAN port on a d-link wireless
 router. I then connect a variety of computers to the d-link's wireless
 network. This provides two virtual network with the same internet
 connection, but different encryption options, coverage areas, etc -
 exactly my goal.

 Yes, this is very unusual (both the network and the behavior), and no,
 I don't want to spend much time trying to fix the problem, but if it's
 something that there's an easy fix to, I'm all for that, otherwise,
 it's just another entry for the quirky things list.

 -Galen

 ___
 Support mailing list
 [EMAIL PROTECTED]
 http://news.gmane.org/gmane.network.freenet.support
 Unsubscribe at
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]


___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] Mac

2004-04-29 Thread Niklas Bergh
Someone answered this question the day before yesterday..

Check here:
http://article.gmane.org/gmane.network.freenet.support/4034

/N
- Original Message - 
From: Keith [EMAIL PROTECTED]
To: [EMAIL PROTECTED]
Sent: Thursday, April 29, 2004 9:48 PM
Subject: [freenet-support] Mac


 How do I install and get running freenet on Mac OSX.3

 ___
 Support mailing list
 [EMAIL PROTECTED]
 http://news.gmane.org/gmane.network.freenet.support
 Unsubscribe at
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]


___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] various problems

2004-04-27 Thread Niklas Bergh


 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of 
 [EMAIL PROTECTED]
 Sent: den 26 april 2004 19:34
 To: [EMAIL PROTECTED]
 Subject: [freenet-support] various problems
 
 
 I wanted to report, that I get currently a lot of the 
 following error messages: Action cannot be taken after 
 termination

Additional logging has been added to unstable to help tracking down this
issue.

java.lang.Exception: debug Please close() me 
 manually in finalizer: Key: *removed* Buffer: 
 [EMAIL PROTECTED]
 * : *removed*:temp:*removed* New: true ( 0 of 262460 read)
 java.lang.IllegalStateException: unclosed

Hmm.. That is an only issue :(

 I do not know, what the error messages mean, but perhaps it 
 has something to do with the following behaviour: Every time 
 I insert something, the value Space used by temp files 
 increases irreversible.

Does it increase _only_ when you insert or will it increase no matter
what?

 It does not matter if the insert 
 succeeds or not (usually not, my current insert speed is 
 between 0kb/s and 1kb/s, sometimes freenet does not manage to 
 get anything inserted for hours), the value increases and 
 never decreases again. The crazy thing about this is, that 
 the temp folder contains at any time only some files (the 
 maximum I observed was something around 20). At one time 
 there was not one single file in the temp folderand freenet 
 reported 200MB of temp files...

There seems to be a whole bunch of different temp files around.. Not
only 'store\temp'... Maybe some of those other contained files?

 This behaviour ends normally 
 in a Java VM crash after some time

What do you mean with crash?

 (I do not think, that the 
 crashes have something to do with this, Java VM crashes 
 occured already before, but just in case...), or, if the 
 reported temp file value reaches around 700MB, in a IO error, 
 because too many files are opened. (Which files?! Some files 
 in the datastore?)

Can you check with the OS which files that are open? I am not a linux
guy but isn't there a command like lsof or something that can do this?

 Freenet is already working with the same 
 settings for months, so I do not think, that I have 
 misconfigured anything, but it may be, that I just had not 
 inserted enough in the past, to notice this behaviour. (The 
 node is running on Linux Mandrake 9.1, so this is definatly 
 not the windows temp file bug or something like that!) A 
 month ago I did not insert much data and I could run freenet 
 for up to 2 days or more on that computer without any crash

Again, what do your mean by crash?

 (as long as I did not put heavy load on the node), so this 
 should have something to do with recent changes, but I could 
 be wrong there. I have already tried various changes to the 
 settings (for example disabling the diagnostics, just in case 
 that they use temp files or disabling the datastore index,

Don't worry.. _that_ they won't do :)

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] Automatic server retry of failing documents

2004-04-27 Thread Niklas Bergh


 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of Ole Tange
 Sent: den 26 april 2004 19:35
 To: [EMAIL PROTECTED]
 Subject: [freenet-support] Automatic server retry of failing documents
 
 
 Quite a few of the documents that I try to get from freenet 
 are not immediately available. Usually I will have to retry a 
 few times every day and then suddenly the document is there. 
 The document can be a file in itself or a part of a multipart 
 download.
 
 Now I believe I can live with freenet being slow and that 
 many documents are not immediately available. What is 
 annoying me is that _I_ will have to do the retrying. Why is 
 that not a task for the server?

You sure? I thought we had a meta-refresh tag on those RNF/DNF pages?
Wont the browser automatically retry the page after a while if you leave
it to?

/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] Re: Question re: accessing my Freenet node fromanother computer

2004-04-27 Thread Niklas Bergh


 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of MonkeyOmen
 Sent: den 22 april 2004 04:15
 To: [EMAIL PROTECTED]
 Subject: [freenet-support] Re: Question re: accessing my 
 Freenet node fromanother computer
 
 
 Niklas Bergh [EMAIL PROTECTED] writes:
  Hmmm.. That ought to do it.. If you spawn a standard apache on the 
  linux machine, can your 10.* machines access pages from it 
  successfully?
 
 Yes.
 
  If not, then I think this is a TCP/IP routing issue... Do 
 the test and 
  we'll talk more it this is the issue.
  
  If they can.. Then I suggest that you crank up the loglevel on your 
  freenet server and track what really happens when your 10.* 
 machines 
  tries to request something from http://192.168.1.10:/
 
 I tried this but couldn't make any sense out of the 
 *enormous* logfile 
 generated.  With logLevel set to Error nothing came up.  With 
 it set to Debug, 
 it's 100,000+ lines in a short time.
 
 Can you tell me what should I search for in the logfile?

Not straight ahead.. But you could try scanning the log file for the
address of the machine that is unable to connect you your freenet server
to see if there is anything obvious around there..


/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] NPE in build 5077

2004-04-27 Thread Niklas Bergh
It is a known issue.. best workaround would probably be to remove the key
from the RSL:s maintenance-queue before actually closing it..

/N
- Original Message - 
From: Marc [EMAIL PROTECTED]
To: [EMAIL PROTECTED]
Sent: Tuesday, April 27, 2004 3:04 PM
Subject: [freenet-support] NPE in build 5077


 Hi,

 I just started to get these in the shell:
 Caught java.lang.NullPointerException running maintenance queue
 java.lang.NullPointerException
 at freenet.ConnectionHandler.getBuf(ConnectionHandler.java:866)
 at
freenet.transport.ReadSelectorLoop.beforeSelect(ReadSelectorLoop.java:140)
 at
freenet.transport.AbstractSelectorLoop.loop(AbstractSelectorLoop.java:734)
 at
freenet.transport.ReadSelectorLoop.run(ReadSelectorLoop.java:669)
 at java.lang.Thread.run(Thread.java:534)

 The log contains the same:
 27.04.2004 14:56:37 (freenet.transport.ReadSelectorLoop, Network reading
thread, ERROR): Caught java.lang.NullPointerException running maintenance
queue
 java.lang.NullPointerException
 at freenet.ConnectionHandler.getBuf(ConnectionHandler.java:866)
 at
freenet.transport.ReadSelectorLoop.beforeSelect(ReadSelectorLoop.java:140)
 at
freenet.transport.AbstractSelectorLoop.loop(AbstractSelectorLoop.java:734)
 at
freenet.transport.ReadSelectorLoop.run(ReadSelectorLoop.java:669)
 at java.lang.Thread.run(Thread.java:534)

 I guess it's a coincidence, but the came after I had a look at the
 environment node info page.
 System is Linux 2.4.25, Sun Java 1.4.2_04 server vm

 Saluton
   Marc
 ___
 Support mailing list
 [EMAIL PROTECTED]
 http://news.gmane.org/gmane.network.freenet.support
 Unsubscribe at
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]


___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] various problems

2004-04-27 Thread Niklas Bergh
  This behaviour ends normally
  in a Java VM crash after some time
 
 What do you mean with crash?
 
 Look at the attachment, I attached some of the error messages of the past
months. They are called HotSpot Virtual Machine Error or something
similiar

Urk, yes.. those are really crashed.. Unfortunately this is nothing that we
can do anything about.. it is a Sun-issue.. or a driver issue or a hardware
issue or something like that.. per definition this kind of crash should be
impossible to cause from a java application inside the JVM :(

/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] Connecting to a non-transient freenet server in a dmz from a dhcp freenet client behind the firewall

2004-04-21 Thread Niklas Bergh


 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of 
 [EMAIL PROTECTED]
 Sent: den 21 april 2004 07:58
 To: [EMAIL PROTECTED]; [EMAIL PROTECTED]
 Subject: [freenet-support] Connecting to a non-transient 
 freenet server in a dmz from a dhcp freenet client behind the firewall
 
 
 Hello,
 
 I have a linux server that I want to run freenet on as a 
 non-transient server hanging off a dsl line. I'd like to use 
 the windows freenet client on a dhcp client as a transient

Windows freenet client? Are you talking about FUQID?

 client so that it only goes to the linux freenet server.

If you tell the client to talk to that server it will talk to that
server only :) More on that below.

E.g. a freenet proxy server if you will.

Hmmm.. I don't really understand that statement.. The freenet
server/node is a freenet server/node and the machine running FIW or
Frost or FUQID or whatever is a client to that server/node...

 Would anyone have any idea how to configure either or both 
 serers to that end.

The freenet server/node has to be told to accept FCP connections from
the client machine. Check the 'fcpHosts' param in the config file, it
accepts both host addresses (e.g. 127.0.0.1, 192.168.0.1 etc) and
network addresses (192.168.1.0/24 etc).

Then the client application (FUQID or whatever) needs to be told to talk
to the freenet server. Check the documentation for the application for
information on how to do this.

/N


___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] Question re: accessing my Freenet node fromanother computer

2004-04-21 Thread Niklas Bergh
 I had no trouble getting the firewall to do the appropriate 
 port forwarding to 
 the server.
 
 Here's the problem.  When I sit at my Linux server, fire up 
 Mozilla, and go to 
 http://127.0.0.1:/ or http://192.168.1.10:/ Freenet 
 works just fine.
 
 When I sit at my laptop and try http://192.168.1.10:/ 
 nothing happens.
 
 My freenet.conf file includes
 
 mainport.allowedHosts=*
 mainport.bindAddress=*
 
 which I thought would allow me to browse my Freenet node from 
 another computer.
 
 What do I need to do to get this to work?

Hmmm.. That ought to do it.. If you spawn a standard apache on the linux
machine, can your 10.* machines access pages from it successfully?

If not, then I think this is a TCP/IP routing issue... Do the test and
we'll talk more it this is the issue.

If they can.. Then I suggest that you crank up the loglevel on your
freenet server and track what really happens when your 10.* machines
tries to request something from http://192.168.1.10:/ 

Cheers
/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] Unable to connect

2004-04-21 Thread Niklas Bergh
Hmm.. Check in your freenet log file (probably 'c:\program
files\freenet\freenet.log') if there is some kind of error message that
might give you a hint (open the file using WordPad)... If it is not
obvious from it what's causing the problem then send the log to the list
and we'll work on from there...

/N

 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of Henry Garcia
 Sent: den 17 april 2004 15:45
 To: [EMAIL PROTECTED]
 Subject: [freenet-support] Unable to connect
 
 
 Downloaded Freenet. Icon is on desktop and systray. When I 
 click to open, I 
 get hourglass symbol for a few seconds then it stops. No 
 connection is made to 
 Freenet. I have a cable modem. Suggestions on possible prob 
 preventing 
 connection.
 Thanks!
 
 I'm quite the newbie to computers so minimum technical jargon 
 would be 
 appreciated.
 
 ___
 Support mailing list
 [EMAIL PROTECTED] 
 http://news.gmane.org/gmane.network.freenet.su pport
 
 Unsubscribe at 
 http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]
 

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] 4 basics questions (transcient node / cache / fec/ version)

2004-04-20 Thread Niklas Bergh

- Original Message - 
From: blured blured [EMAIL PROTECTED]
To: [EMAIL PROTECTED]
Sent: Sunday, April 18, 2004 2:16 AM
Subject: [freenet-support] 4 basics questions (transcient node / cache /
fec/ version)


 1. How to make my node not transcient? I'm on linux with permanent
connexion

Either run it on a machine with a public IP-address or configure the public
IP address in the configuration file while port-forwarding the listenPort to
the node-running machine from the address-owning one (usually the firewall).

 2. How to increase my cache of data ?

Set the 'storeSize' parameter in the configuration file to a larger value

 4. How do I know the latest version of freenet ?

If there is a new version known this information is displayed in the node's
web interface. Another good way of keeping up-to-date is to subscribe to
this mailing list. New releases are announced here.

/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] Newbie help WinXP cannot accesshttp://127.0.0.1:8888/

2004-04-15 Thread Niklas Bergh
 Below is the beginning of my log

 Apr 15, 2004 2:08:34 AM (freenet.node.Main, main, NORMAL): Starting
 Freenet (Fred) 0.5 node, build #5076 on JVM Sun Microsystems Inc.:Java
 HotSpot(TM) Client VM:1.4.0_01-ea-b02

It's a rather old JVM, you should try to upgrade to 1.4.2. As for the
other messages, none of them looks critical, but if you get a lot of
them, they might indicate a problem with the JVM..

It actually is so old that we _know_ there are bugs in it which prevents
fred from working correctly :)

/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] NAT Freenet

2004-04-11 Thread Niklas Bergh

- Original Message - 
From: Galen [EMAIL PROTECTED]
To: [EMAIL PROTECTED]
Sent: Saturday, April 10, 2004 8:05 AM
Subject: [freenet-support] NAT  Freenet


 Hi,

 One of the places where I would like to use freenet is behind NAT. I
 know all about port mapping, but this simply isn't available in this
 situation.

 What is the hope of running Freenet?

 I know virtually every other protocol has implemented support for NAT
 as part of (or before) becoming mainstream... if this doesn't exist in
 freenet as of now, it might be something important if freenet were to
 ever become widely used.

It is planned for.. not there yet though

But.. due to the new BiDi facilities (in current unstable) my non-NATed node
have started working suprisingly well..

/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] load average is too high

2004-04-06 Thread Niklas Bergh
 It took several minutes for the General page to come up.
 messageSendTimeRequest is 0, which probably doesn't tell you anything, so
 here's the page.

Hmm. It's really struggling, even though it's not doing anything...
I dunno what we can do about it...

Produce a couple of full stackdumps to see where the threads are stuck?

/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] Re: My freenet installation experiences

2004-03-29 Thread Niklas Bergh
 If I run as a full node (non-transient), would it 'hurt' the 
 network that I am only connected a few hours a day on a slow 
 connection?

Well.. The slow part wont matter really but the 'few hours' part might..

 Even though I have doannounce set to false, my log file is 
 filled with request rejected, node is transient' messages. 
 Is this normal?

Well.. Possibly.. Might it be so that your node has announced at a
previous time?

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] Route not found - stability next generationrouting

2004-03-21 Thread Niklas Bergh
 2) Even after having the node up for a wile and(!)
 successfully downloading content, the node more often
 fails to route the request to other nodes than before
 NG-routing. Wihtout NG routing I was able to have
 request returned with 25 HTL with a data not found
 error - a clear indication that the data was not there
 for sure. With NG routing I am having trouble to get a
 data-not found message at all, most of the errors I
 only get route not found with 1 or 2 nodes or even 0
 being contacted.

This is probably due to the recent Rate limiting facilites more than to
NGRouting.. Ratelimiting will cause RNFs when your node overloads it
neighbours with requests..

 Now to my questions:
 a) is there a way to make my freenet node try to
 contact NEW nodes more often? For example by more
 aggressivle cleaning up the routing table?

Well.. you could try increasing the size of the routing table maybe..

 b) How can I tweak routing that my node (AFTER
 successfully receiving data!) does no longer think, it
 does no know where to deliver the requests to?
 c) Why does my node deliver route not found errors
 with onlny a few ( 5) other nodes it tried to
 contact? How can I make it contact more nodes? ( 20)

This probably is partly due to a bug or two..however.. there might also be
valid reasons for this behaviour..it is not impossible that your node
doesn't _have_ any more nodes to contact (your node might have reached its
request quota for all other nodes it knows about for instance etc.)

 d) Do nodes tell each other about the nodes they know?

Yes.. information about other, new nodes are passed along within certain
freenet messages.

 e) is it easy to get involved in the freenet
 development?

Yes, quite easy.. however.. the code isn't eceptionally well documented..

/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] OutOfMemoryError

2004-03-16 Thread Niklas Bergh
Fwolff said:

And to the philosophy of some devs: RAM is cheap
New SDRAM will be detected only with half of it's normal size or even not
detected at all in old computers

When I was having problems with half-size-detected issues it turned out that
it was due to the old motherboard only managing to detect one _side_ of any
double-sided SDRAMs...

/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] Way to much RAM! Build 5064

2004-02-18 Thread Niklas Bergh
 I've repeatedly seen old machines like my P3-600 disregarded as
 irrelevant, and not worth optimizing for, in terms of the Freenet
 network.

See above. The best thing I can do for you is get rate limiting working
properly. And I think Freenet should easily run on a 600MHz machine, or
something is wrong. I'm just skeptical about running on 128MB, or on
200MHz machines.

I dont think it impossible to run a node on 128MB.. However.. if the OS uses
up 80 of those we will definitely end up having problems.


/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] routing table

2004-02-15 Thread Niklas Bergh
 It is noticeable that Freenet uses a ridiculous amount of RAM.  If I run
 top on a node that connects to only one other node, and sporadically at
 that, I see that it is using 79 MB of memory.  The number doesn't appear
 to grow -- there is no evidence of a memory leak -- but it starts out and
 remains huge.

 My single inactive node doesn't transmit any messages.  The only thing
 that could account for the 79 MB of memory used would seem to be
 routing information relating to the 98 nodes it knows about:

Please help out. Fire up a memory profiler of your choice at your machine
and tell me what it is that occupies all that memory. When I do the same on
my machine the node wont use more than 10-15 megs of memory.

/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] routing table

2004-02-14 Thread Niklas Bergh
 Is it a VM bug or is it just creating 
 objects it theoretically could reach (thus they don't get GC'd), but 
 ignores forever?

The second it what is defined as a 'memory leak' in GC'd environments.

/N
___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] routing table

2004-02-13 Thread Niklas Bergh
Title: Message



The 
routingtable filesare thertnodes_* and rtprops_* files in your 
choosenfreenet install folder. However.. these filesoccupies 
onlya few kilobytes of your harddrive.

Is it HD 
space or RAM memory you want to free up?

/N

  
  -Original Message-From: 
  [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] 
  On Behalf Of Robert GreenageSent: den 13 februari 2004 
  04:32To: [EMAIL PROTECTED]; 
  [EMAIL PROTECTED]Subject: [freenet-support] routing 
  table
  
  which folder in windows contains the routing table that needs to be 
  deleted in order to free up memory?
  
  
  --- Robert Greenage
  --- [EMAIL PROTECTED]
  --- EarthLink: It's your Internet.
  
  
___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]

RE: [freenet-support] Probably a simply problem I'm having...

2004-02-13 Thread Niklas Bergh
Yea... It kinda looks like you 'node' file is corrupt. Could you send it
over to me (I want to see what is wrong with it) and then delete it and
try restarting the node again? The 'node' file ought to be present in
'c:\program files\freenet'.

/N

 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of Marcus
 Sent: den 13 februari 2004 11:36
 To: [EMAIL PROTECTED]
 Subject: [freenet-support] Probably a simply problem I'm having...
 
 
 Hi all,
 
 Have had freenet up and running before I got a few (23) 
 viruses on my PC (not through freenet). Got rid of them, 
 reloaded windows, re-installed freenet and now can't get the 
 Gateway to open. My little bunny icon isn't turning blue 
 anymore!! Help!!!
 
 I know you guys have got some much more serious issues at the 
 moment but any help would be much appreciated. Here is what 
 the logfile says:
 
 12-Feb-2004 00:00:04 (freenet.node.Main, main, NORMAL): 
 Starting Freenet
 (Fred) 0.5 node, build #5068 on JVM Sun Microsystems 
 Inc.:Java HotSpot(TM) Client VM:1.4.2_03-b02 12-Feb-2004 
 00:00:04 (freenet.node.Main, main, NORMAL): loading node 
 keys: node 12-Feb-2004 00:00:04 (freenet.node.Main, main, 
 ERROR): Unexpected Exception: java.io.EOFException
 java.io.EOFException  at
 freenet.support.io.ReadInputStream.readUTFChar(ReadInputStream
 .java:223)at
 freenet.support.io.ReadInputStream.readToEOF(ReadInputStream.j
 ava:134)  at
 freenet.support.io.CommentedReadInputStream.readToEOF(Commente
 dReadInputStre
 am.java:45)   at
 freenet.support.io.ReadInputStream.readToEOF(ReadInputStream.j
 ava:184)  at
 freenet.FieldSet.privParse(FieldSet.java:609) at
 freenet.FieldSet.parseFields(FieldSet.java:497)   at
 freenet.FieldSet.parseFields(FieldSet.java:433)   at
 freenet.FieldSet.init(FieldSet.java:88) at
 freenet.node.Main.loadNodeFile(Main.java:3408)at
 freenet.node.Main.main(Main.java:557)
 
 I am guess this has something to do with an Unexpected 
 Exception whatever this means. Hope someone will make more 
 sense of this than me. Many thanks, Marcus.
 
 
 
 ___
 Support mailing list
 [EMAIL PROTECTED] 
 http://news.gmane.org/gmane.network.freenet.su pport
 
 Unsubscribe at 
 http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]
 

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] Probably a simply problem I'm having...

2004-02-13 Thread Niklas Bergh
[EMAIL PROTECTED]

It is named simply 'node', not 'node.file' but yes.. I think we might be
talking about the same file. Yes, just delete it and restart the node
(it ought to create a new file what that is done).

/N

 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of Marcus
 Sent: den 13 februari 2004 13:36
 To: [EMAIL PROTECTED]
 Subject: RE: [freenet-support] Probably a simply problem I'm having...
 
 
 Thank you so much Niklas,
 What is your e-mail address and it will be on it's way. Is 
 that all I need to do, just delete it? Is it the 'node.file' 
 mine is 1kb. Does this look right?
 
 Again many thanks, Marcus
 
 -Original Message-
 From: [EMAIL PROTECTED]
 [mailto:[EMAIL PROTECTED] Behalf Of Niklas Bergh
 Sent: 13 February 2004 10:43
 To: [EMAIL PROTECTED]
 Subject: RE: [freenet-support] Probably a simply problem I'm having...
 
 
 Yea... It kinda looks like you 'node' file is corrupt. Could 
 you send it over to me (I want to see what is wrong with it) 
 and then delete it and try restarting the node again? The 
 'node' file ought to be present in 'c:\program files\freenet'.
 
 /N
 
  -Original Message-
  From: [EMAIL PROTECTED]
  [mailto:[EMAIL PROTECTED] On Behalf Of Marcus
  Sent: den 13 februari 2004 11:36
  To: [EMAIL PROTECTED]
  Subject: [freenet-support] Probably a simply problem I'm having...
 
 
  Hi all,
 
  Have had freenet up and running before I got a few (23) 
 viruses on my 
  PC (not through freenet). Got rid of them, reloaded windows, 
  re-installed freenet and now can't get the Gateway to open. 
 My little 
  bunny icon isn't turning blue anymore!! Help!!!
 
  I know you guys have got some much more serious issues at 
 the moment 
  but any help would be much appreciated. Here is what the 
 logfile says:
 
  12-Feb-2004 00:00:04 (freenet.node.Main, main, NORMAL): Starting 
  Freenet
  (Fred) 0.5 node, build #5068 on JVM Sun Microsystems Inc.:Java 
  HotSpot(TM) Client VM:1.4.2_03-b02 12-Feb-2004 00:00:04 
  (freenet.node.Main, main, NORMAL): loading node
  keys: node 12-Feb-2004 00:00:04 (freenet.node.Main, main,
  ERROR): Unexpected Exception: java.io.EOFException
  java.io.EOFExceptionat
  freenet.support.io.ReadInputStream.readUTFChar(ReadInputStream
  .java:223)  at
  freenet.support.io.ReadInputStream.readToEOF(ReadInputStream.j
  ava:134)at
  freenet.support.io.CommentedReadInputStream.readToEOF(Commente
  dReadInputStre
  am.java:45) at
  freenet.support.io.ReadInputStream.readToEOF(ReadInputStream.j
  ava:184)at
  freenet.FieldSet.privParse(FieldSet.java:609)   at
  freenet.FieldSet.parseFields(FieldSet.java:497) at
  freenet.FieldSet.parseFields(FieldSet.java:433) at
  freenet.FieldSet.init(FieldSet.java:88)   at
  freenet.node.Main.loadNodeFile(Main.java:3408)  at
  freenet.node.Main.main(Main.java:557)
 
  I am guess this has something to do with an Unexpected Exception 
  whatever this means. Hope someone will make more sense of this than 
  me. Many thanks, Marcus.
 
 
 
  ___
  Support mailing list
  [EMAIL PROTECTED] 
  http://news.gmane.org/gmane.network.freenet.su pport
 
  Unsubscribe at 
  http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
  Or mailto:[EMAIL PROTECTED]
 
 
 ___
 Support mailing list
 [EMAIL PROTECTED] 
 http://news.gmane.org/gmane.network.freenet.su pport
 
 Unsubscribe at 
 http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]
 
 
 ___
 Support mailing list
 [EMAIL PROTECTED] 
 http://news.gmane.org/gmane.network.freenet.su pport
 
 Unsubscribe at 
 http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]
 

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] Crashes with 6469

2004-02-10 Thread Niklas Bergh


 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of 
 [EMAIL PROTECTED]
 Sent: den 10 februari 2004 12:26
 To: [EMAIL PROTECTED]
 Subject: [freenet-support] Crashes with 6469
 
 
 After updating to 6469 I always get this log entry right 
 after starting the node, before the first request is made.
 
 12:13:07 Size was wrong reading in SimpleDataObjectStore 

This is prbably not causing you trouble.. I have committed some logging
changes that will better say what the cause is now (will incluse a
callstack and what the atual sizes are). Let me know what it says.

Regards
/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


Re: [freenet-support] Compiling freenet with gcj

2004-02-05 Thread Niklas Bergh
Committed to unstable CVS.

/N
- Original Message - 
From: Ruben Garcia [EMAIL PROTECTED]
To: [EMAIL PROTECTED]
Sent: Wednesday, February 04, 2004 4:57 PM
Subject: [freenet-support] Compiling freenet with gcj


 I found the problem.
 this patch should be applied to stable in order to be able to compile it
 with gcj.







 diff -ur alt.source/src/freenet/node/rt/DecayingKeyspaceEstimator.java
source/src/freenet/node/rt/DecayingKeyspaceEstimator.java
 --- alt.source/src/freenet/node/rt/DecayingKeyspaceEstimator.java Tue Jan
13 06:02:08 2004
 +++ source/src/freenet/node/rt/DecayingKeyspaceEstimator.java Wed Feb  4
16:49:05 2004
 @@ -914,7 +914,7 @@
   /*
   * @see freenet.node.rt.KeyspaceEstimator#getReport()
   */
 - public HTMLReportTool getHTMLReportingTool() {
 + public KeyspaceEstimator.HTMLReportTool getHTMLReportingTool() {
   return new StandardHTMLReportTool();
   }








 ___
 Support mailing list
 [EMAIL PROTECTED]
 http://news.gmane.org/gmane.network.freenet.support
 Unsubscribe at
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] Sun JRE 1.5.0 beta is a no go for Freenet

2004-02-05 Thread Niklas Bergh
And here is the relevant documentation from sun:

Keys may be removed from, but not directly added to,
the selected-key set. Any attempt to add an object
to the key set will cause an UnsupportedOperationException
to be thrown.

Someone: you could try to remove the call to fixKeys at
AbstractSelectorLoop.java:692

Regards
/N

 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of Someone
 Sent: den 5 februari 2004 16:28
 To: [EMAIL PROTECTED]
 Subject: [freenet-support] Sun JRE 1.5.0 beta is a no go for Freenet
 
 
 Hi,
 
 just giving the new Sun JRE 1.5.0 beta a try. It promises 
 about improved Performance made me hope that it could help me 
 to run a stable node. But it doesn't work a bit at the 
 moment. It just spams the error log (about 10 MB logdata per 
 Minute) with the
 following:
 
 05.02.2004 16:20:11 (freenet.transport.WriteSelectorLoop,  
 write interface 
 thread, ERROR): Caught throwable in AbstractSelectorLoop!: 
 java.lang.UnsupportedOperationException
 java.lang.UnsupportedOperationException
   at sun.nio.ch.Util+1.add(Unknown Source)
   at 
 freenet.transport.WriteSelectorLoop.fixKeys(WriteSelectorLoop.
 java:331)
   at 
 freenet.transport.AbstractSelectorLoop.loop(AbstractSelectorLo
 op.java:692)
   at 
 freenet.transport.WriteSelectorLoop.run(WriteSelectorLoop.java:747)
   at java.lang.Thread.run(Unknown Source) 
 java.lang.UnsupportedOperationException
   at sun.nio.ch.Util+1.add(Unknown Source)
   at 
 freenet.transport.WriteSelectorLoop.fixKeys(WriteSelectorLoop.
 java:331)
   at 
 freenet.transport.AbstractSelectorLoop.loop(AbstractSelectorLo
 op.java:692)
   at 
 freenet.transport.WriteSelectorLoop.run(WriteSelectorLoop.java:747)
   at java.lang.Thread.run(Unknown Source) 
 java.lang.UnsupportedOperationException
   at sun.nio.ch.Util+1.add(Unknown Source)
   at 
 freenet.transport.WriteSelectorLoop.fixKeys(WriteSelectorLoop.
 java:331)
   at 
 freenet.transport.AbstractSelectorLoop.loop(AbstractSelectorLo
 op.java:692)
   at 
 freenet.transport.WriteSelectorLoop.run(WriteSelectorLoop.java:747)
   at java.lang.Thread.run(Unknown Source) 
 java.lang.UnsupportedOperationException
   at sun.nio.ch.Util+1.add(Unknown Source)
   at 
 freenet.transport.WriteSelectorLoop.fixKeys(WriteSelectorLoop.
 java:331)
   at 
 freenet.transport.AbstractSelectorLoop.loop(AbstractSelectorLo
 op.java:692)
   at 
 freenet.transport.WriteSelectorLoop.run(WriteSelectorLoop.java:747)
   at java.lang.Thread.run(Unknown Source) 
 java.lang.UnsupportedOperationException
   at sun.nio.ch.Util+1.add(Unknown Source)
   at 
 freenet.transport.WriteSelectorLoop.fixKeys(WriteSelectorLoop.
 java:331)
   at 
 freenet.transport.AbstractSelectorLoop.loop(AbstractSelectorLo
 op.java:692)
   at 
 freenet.transport.WriteSelectorLoop.run(WriteSelectorLoop.java:747)
   at java.lang.Thread.run(Unknown Source)
 
 So it seems eighter fred is incompatible with the new JRE or 
 it is due its beta state (although I never had such a Problem 
 with the 1.4 betas before).
 
 Greets someone
 
 ___
 Support mailing list
 [EMAIL PROTECTED] 
 http://news.gmane.org/gmane.network.freenet.su pport
 
 Unsubscribe at 
 http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]
 

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] Failed to send IdentifyPacketMessage Errors

2004-02-04 Thread Niklas Bergh
It is an effect of a connection being closed quite immediately after it
was opened. Could we move the enqueueing of the identify message a
little while later?

/N

 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of 
 Nikita Proskourine
 Sent: den 4 februari 2004 01:04
 To: [EMAIL PROTECTED]
 Subject: Re: [freenet-support] Failed to send 
 IdentifyPacketMessage Errors
 
 
 I doubt this is new. I see these with older builds on my 
 machine a lot 
 as well.
 
 Nikita.
 
 Kevin Bennett wrote:
 
 Seeing hundreds of these today, roughly between 1 and 4 per second:
 
 03-Feb-2004 21:39:35 (freenet.IdentifyPacketMessage, YThread-42, 
 NORMAL): Failed to send IdentifyPacketMessage: 
 freenet.SendFailedException: Against peer DSA(removed) @ 
 removed - Sent 
 0 bytes (1551 of packet in notifyDone
 (nonterminal)
 freenet.SendFailedException: Against peer DSA(removed) @ 
 removed - Sent 0
 bytes (1551 of packet in notifyDone (nonterminal)
  at freenet.PeerPacket.jobDone(PeerPacket.java:180)
  at 
 freenet.MuxConnectionHandler.terminate(MuxConnectionHandler.java:294)
  at 
 freenet.PeerHandler.registerConnectionHandler(PeerHandler.java:650)
  at
 freenet.MuxConnectionHandler.setPeerHandler(MuxConnectionHand
 ler.java:152)
  at 
 freenet.OpenConnectionManager.put(OpenConnectionManager.java:235)
  at 
 freenet.MuxConnectionHandler.registerOCM(MuxConnectionHandler.
 java:501)
  at
 freenet.interfaces.FreenetConnectionRunner.handle(FreenetConn
 ectionRunner.ja
 va:141)
  at
 freenet.interfaces.PublicNIOInterface$ConnectionShell.run(Pub
 licNIOInterface
 .java:150)
  at 
 freenet.thread.YThreadFactory$YThread.run(YThreadFactory.java:247)
 
 Does this mean anything, or is it just a glitch?  I reseeded 
 earlier on 
 (the node wasn't transferring any data at all).  Could 
 reseeding have 
 made this start happening?
 
 Kevin.
 
 
 ___
 Support mailing list
 [EMAIL PROTECTED] 
 http://news.gmane.org/gmane.network.freenet.support
 Unsubscribe at 
 http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]
   
 
 
 ___
 Support mailing list
 [EMAIL PROTECTED] 
 http://news.gmane.org/gmane.network.freenet.su pport
 
 Unsubscribe at 
 http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]
 

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] Way to much RAM! Build 5064

2004-01-28 Thread Niklas Bergh


 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of S
 Sent: den 28 januari 2004 13:57
 To: [EMAIL PROTECTED]
 Subject: Re: [freenet-support] Way to much RAM! Build 5064
 
 
 On Wed, 28 Jan 2004 13:33:42 +0100
 Maximilian Mehnert [EMAIL PROTECTED] wrote:
 
  Freenet is one of the most beautiful ideas I ever hit on.
  But it should be possible to run it on a small pentium 
 machine with no 
  more than 100MB of RAM.
 
 I agree 100%. I have a machine dedicated to Freenet. It 
 doesn't do anything else, period. It's a P3 600mhz with 192 
 megs of RAM. Both stable and unstable will max out its CPU 
 most of the time. I suspect that the core issue is RAM, but I 
 don't know for sure.

Hmm.. Not necessarily I have loads of ram and a similar CPU and it is
still maxed out :)

/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] Route not found

2004-01-26 Thread Niklas Bergh
Hmmm.. That page isn't the routing page.. It is the connections page..
The routing table can be viewed at
http://localhost:/servlet/nodestatus/nodestatus.html

But in principle you are correct. If a node is integrated into the
network, not transient and able to receive inbound connections you ought
to be able to see inbound connections within a day or two.

regards
/N

 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of 
 Phillip Hutchings
 Sent: den 25 januari 2004 00:14
 To: [EMAIL PROTECTED]
 Subject: Re: [freenet-support] Route not found
 
 
 Try today, freenet seems a bit healthier today. It currently seems to 
 have a day down, then a day up. Weird.
 
 Looking at my routing table, it's pretty much the same, only 
 outgoing. 
 To me it seems like the routing table isn't growing - Freenet isn't 
 discovering more nodes, which leads to the seed nodes being 
 overloaded 
 and dropping queries. My node is dropping queries 50% of the 
 time when 
 I use it as well.
 
 Maybe we need somewhere where people can drop their noderefs 
 and others 
 can get a random seednodes.ref file from that, rather than the static 
 version at the moment.
 
 On 24/01/2004, at 10:12 AM, Peter T. Mayer wrote:
 
  After runnig freenet for at least 10 hours. My routingtable 
 looks like
  the following:
 
  ...
  As you can see there are only outbound connections. Also I can not
  receive any pages. It worked for me until 3 months before. 
 But then I 
  made an update and now I can't use Freenet anymore. First I thougt 
  there are some problems with the software, wich will be 
 fixed in the 
  next days, but today I realized that others can use freenet.
 
  I run Build: 5063 under linux. I have no firewall software installed
  and I don't have to use a proxy server. Has anyody an idea, 
 why I have 
  these problems?
 
  With kind regards,
 
  Peter T. Mayer
 
  PS: When I want to
  accesshttp://dodo.freenetproject.org/pipermail/support/from the 
  support www page, I get an Error 403: You don't have permission to 
  access /pipermail/support/ on this server.
 
 Archives are at http://news.gmane.org/gmane.network.freenet.support
 
 --
 Phillip Hutchings
 [EMAIL PROTECTED]
 http://www.sitharus.com/
 

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] number of connections

2004-01-26 Thread Niklas Bergh
Well, If it works fine for you I think you should keep it. But..
Remember that for each connection that needs to be negotiated (the more
ones allowed the less needs to be established), this increases you CPU
load.

Another issue is that fred requires you to allow for at least two
connections per node in your rt.. If you have configured your node to
allow only 20 connections your routing table will be reduces to only 10
nodes..

/N

 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of Steven
 Sent: den 25 januari 2004 08:21
 To: [EMAIL PROTECTED]
 Subject: [freenet-support] number of connections
 
 
 since multiplexing has been ported to the stable branch of 
 freenet, we can 
 have a MUCH lower maxConnection setting right?  I used allow 
 300, now I only 
 allow 20.  Is this a bad idea?  
 
 I've had a lot of traffic on my node, and everything seems to 
 be working fine 
 (although connecting initially took forever) according to the 
 numbers, but i 
 can't retrieve much.  
 
 
 ___
 Support mailing list
 [EMAIL PROTECTED] 
 http://news.gmane.org/gmane.network.freenet.su pport
 
 Unsubscribe at 
 http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
 Or mailto:[EMAIL PROTECTED]
 

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support
Unsubscribe at http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
Or mailto:[EMAIL PROTECTED]


RE: [freenet-support] FreeBSD : IPAddressDetector : SocketExceptiontrying to detect NetworkInterfaces

2004-01-22 Thread Niklas Bergh
This is not a problem with freenet. I might be a JVM bug.. Maybe it has
something to do with IPv6/IPv4 interfaces or something, do you have any
IPv6 interfaces?

Read here to see that this can happen wheter or not freenet is involved.
http://thread.gmane.org/gmane.os.freebsd.devel.java/2866

And read here to see that we too have encountered the problem before and
to learn the workaround I suggested at that time (please verify if it
works).
http://thread.gmane.org/gmane.network.freenet.support/1196

Regards
/N

 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of Tapio Valli
 Sent: den 21 januari 2004 18:25
 To: [EMAIL PROTECTED]
 Subject: [freenet-support] FreeBSD : IPAddressDetector : 
 SocketExceptiontrying to detect NetworkInterfaces
 
 
 
 Correcting the *** header/subject, sorry about that.
 
  
  Hello,
  
  I am having difficulties my emails through to 
  [EMAIL PROTECTED] I use that address but my mails haven't 
  made it to list so far?
  
  Anyway, my problem below persists and now it appears to be blocking 
  the connectivity for Frost client as Frost can't update 
 lists and in 
  freenet.log I am getting lots of these :
  
  Jan 18, 2004 1:20:46 PM (freenet.node.IPAddressDetector, 
 QThread-879, 
  ERROR): No addresses found!
  Jan 18, 2004 1:20:57 PM (freenet.node.IPAddressDetector, 
 QThread-856, ERROR):
  No
  addresses found!
  Jan 18, 2004 1:21:08 PM (freenet.node.IPAddressDetector, 
 QThread-879, ERROR):
  No
  addresses found!
  Jan 18, 2004 1:21:19 PM (freenet.node.IPAddressDetector, 
 QThread-894, ERROR):
  No
  addresses found!
  Jan 18, 2004 1:21:29 PM (freenet.node.IPAddressDetector, 
 QThread-896, ERROR):
  No
  addresses found!
  
  Please refer to below email for more details :
  
  
  On Thu, 15 Jan 2004 19:09:44 +0200
  Tapio Valli [EMAIL PROTECTED] wrote:
  
   
   Hello,
   
   I am running the stable 5060 build with following system :
   
   javavm -version
   Java HotSpot(TM) Client VM
   java version 1.4.1
   Java(TM) 2 Runtime Environment, Standard Edition (build
  Blackdown-1.4.1-01)
   Java HotSpot(TM) Client VM (build Blackdown-1.4.1-01, mixed mode)
   
   FreeBSD 5.2-CURRENT
   
   My freenet.conf should be ok as well as my NAT/port forwarding.
   
   Right at start-up of the node, I get :
   
   Jan 15, 2004 6:53:38 PM (freenet.node.Main, main, 
 NORMAL): Read node 
   file Jan 15, 2004 6:53:42 PM 
 (freenet.node.IPAddressDetector, main, 
   ERROR):
  SocketException trying to
   detect NetworkInterfaces
   java.net.SocketException: Bad address
   at java.net.NetworkInterface.getAll(Native Method)
   at
  
 java.net.NetworkInterface.getNetworkInterfaces(NetworkInterface.java:2
  04)
   at
  freenet.node.IPAddressDetector.checkpoint(IPAddressDetector.java:96)
   at
  freenet.node.IPAddressDetector.getAddress(IPAddressDetector.java:68)
   at
  freenet.node.IPAddressDetector.getAddress(IPAddressDetector.java:49)
   at freenet.node.Main.main(Main.java:605)
   Jan 15, 2004 6:53:45 PM (freenet.node.Main, main, 
 NORMAL): starting
  filesystem
   
   But the node starts anyhow. How significant is this and 
 what I can 
   do to
  fix it?
   When running, I get these, like 2-3 times a minute.
   
   Thanks,
   
   Tapio Valli
   
   
   --
  
  
  --
  ___
  Support mailing list
  [EMAIL PROTECTED]
  http://news.gmane.org/gmane.network.freenet.support
  
 
 
 ___
 Support mailing list
 [EMAIL PROTECTED]
 http://news.gmane.org/gmane.network.freenet.support
 

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support


Re: [freenet-support] access to freenet using windows98

2004-01-20 Thread Niklas Bergh
Yes, you should update. Try the 'update snapshot' link in the Freenet folder
in your start menu.

Cheers
/N
- Original Message - 
From: william johnston [EMAIL PROTECTED]
To: [EMAIL PROTECTED]
Sent: Tuesday, January 20, 2004 5:20 PM
Subject: [freenet-support] access to freenet using windows98


 Hello. I have had a similar problem with freenet outlined by another
windows98 user, having installed it from free cdrom. Everything went ok,
user node set up, etc. Initially it was prob with zonealarm firewall next
time tried,so I shut that down, and was able to open the gateway fine. but
then couldn't access any of the sites listed, with similar time out
messages. I only have connections to about 2 out of 20 nodes at any one time
from looking at the usage and network info, so guess that is the problem, as
I see most here seem to have many more, but not sure what to do to improve
this figure, or get further. Have in the past installed linux os variants on
a virtual partition, but now have no space for that, so prefer to stick with
98 for the time being. Thanks for any help

 Will

 ps using version 0.5.2.7 - should I update, and how do I get the download?
 ___
 Support mailing list
 [EMAIL PROTECTED]
 http://news.gmane.org/gmane.network.freenet.support


___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support


Re: [freenet-support] Odd failure(?) mode, and updating.

2004-01-16 Thread Niklas Bergh

- Original Message - 
From: Paul Derbyshire [EMAIL PROTECTED]
To: [EMAIL PROTECTED]
Sent: Friday, January 16, 2004 8:30 AM
Subject: [freenet-support] Odd failure(?) mode, and updating.


 You may remember me as the one who had problems with fproxy that
 proved to be brain-dead IE defaults. Turns out fproxy and my node are
 working fine, and the node gets around 1 request a second suggesting
 it's integrating way better than the freesite of evil keeps bitching
 about. :)

 Reachability of stuff browsed through the interface seems to improve
 as it gels into the network.

Good to hear, that is one of the reasons the why it is good to run a
permanent node.

 Then this AM there was an incident, which happened to catch me in
 front of the keyboard. It was hard not to notice, since the whole
 system became largely unresponsive. For whatever reason, my node had
 spawned over 5000 new threads in a matter of seconds and bloated to
 take up much more RAM and most of the CPU, forcing me to restart the
 service from the tray menu. Hopefully enough is cached between
 sessions that this won't seriously compromise the node's integration.

 I have a number of new questions, none of which the FAQ will answer.
 1. What caused this? I've heard of some versions grabbing a lot of
 system resources when inserting certain kinds of keys locally through
 FCP, but not spontaneously or as a result of requests. Can it happen
 when some kinds of keys are inserted by just propagating to your
 node? Was it trying to upload and store a large file, maybe one that
 came in 5000 asynchronous fragments? Pathological behavior that
 cripples the host system until the node is restarted manually,
 possibly then hurting the network by interrupting what would have
 been an important task for others or by setting back the integration
 clock on your node is, IMO, bad. Thread, CPU, and memory use may
 need to be throttleable as bandwidth currently is. (The same applies
 double to the gnutella client I run, though, which frequently bloats
 up to 2000 threads and uses way more ram than the freenet node under
 normal circumstances -- i.e. normal for the node AND the gnutella
 client. :))

The theory is that this happens when the node finishes a huge bunch of stuff
at the same time (for instance when we have queued lost of messages to
another node and then that dies.. suddenly we have large amounts of failure
messages to handle). And.. even worse, when the node has huge amounts of
threads running it will have problems catching up since we all the time
receives more messages etc over the network that are supposed to be
processed - even more threads spawned

 2. Is this already addressed by the update?

It is in the version you are running even.. set the config param
'threadFactory=Y' in the freenet.ini file (dont forget to remove the '%'
comment sign). This will cause your node to use another threadfactory which
respects the tfAbsoluteMaxThreads param (which defaults to 500 or so)

 4. My machine seems to get a new IP address every so often,
 automagically, and not just after a reboot. How well will the node
 handle that?:

It checks periodically.

   a. Will it start screwing up if the IP changes mid-session and have
 to be manually restarted? How to detect this or better yet, automate
 it? Short of restarting it on a fixed schedule, which would probably
 be bad. Or will it discover the new ip for itself? Perhaps as long as
 it works OK without uncommenting and changing the ipAddress line in
 freenet.ini it will cope automatically?

Yes

   b. How bad an effect on the network will the dynamic IP have,
 especially if it requires periodic node restarts beyond the usual
 Windows had a cerebral embolism in its atrophied and still largely
 16-bit brain; time to reboot again, sigh situations?
 I'd rather avoid the dyndns.org service that I was shocked to find
 pimped in a comment in the configuration file. Shocked, because of
 this from its Click-through Terms of Service Of The Week(tm by
 Microsoft who pioneered the practise):

Sure, a fixed IP would of course be better but fred is designed to cope with
IP changes (read up on what ARK's (freenet only term) are if you want
details)

/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support


RE: [freenet-support] Which JRE is recommended for Win2k

2004-01-16 Thread Niklas Bergh

 I'm running with the IBM JVM 1.4.1 wich has (at least under 
 linux) dramatically better performances than the SUN JVM.

And is not available for windows yet :(

I am running 1.4.2_03 and cannot say I am seeing any problems that are
caused by the actual JVM version...

/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support


RE: [freenet-support] Re: Which JRE is recommended for Win2k

2004-01-16 Thread Niklas Bergh


 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of Someone
 Sent: den 16 januari 2004 13:51
 To: [EMAIL PROTECTED]
 Subject: [freenet-support] Re: Which JRE is recommended for Win2k
 
 
 Herve Lefebvre schrieb:
 
  What kind of errors ?
 
 I already reported them here and mailed some log files to toad.
 
  or maybe a configuration problem.
 
 It is mainly on default configuration, I just had to reduce 
 the max connections to 80 because of my cheap SOHO router. 
 And with the builds previous to 5054 (the non mux builds) it 
 run for days without errors in the log, CPU and memory usage 
 was quite high but it didn't stall.
 
  I'm running with the IBM JVM 1.4.1 wich has (at least under linux) 
  dramatically better performances than the SUN JVM.
 
 Is there a stand alone JRE from IBM? I just found the big JDK 
 for Windows, which isn't good according to the readme of fred.

Does it really include the 1.4.1 JVM or does it only include the 1.3.1
one? If it includes 1.4.1 I'd really much like to know where I can
download it.

/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support


RE: [freenet-support] 5061 Observations questions

2004-01-16 Thread Niklas Bergh


 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of Kevin Steen
 Sent: den 16 januari 2004 12:35
 To: [EMAIL PROTECTED]
 Subject: [freenet-support] 5061 Observations  questions
 
 
 Some observations from my 5061 node, ocmContents page (and 
 the resulting questions to enhance my understanding of what's 
 going on.) :
 
 Established node, restarted and run for 2 hrs:
 Total amount of messages transfered
 Type
 Sent/Received
 DataNotFound
28/58
 InsertReply
  1/1
 StoreData
16/12
 Accepted
28/57
 NodeAnnouncement
  0/3
 QueryRestarted
28/59
 InsertRequest
56/25
 DataReply
16/17
 QueryRejected
29/65
 DataInsert
  1/5
 DataRequest
67/29
 QueryAborted
  3/3
 
 + Shouldn't sent InsertRequests always be = received InsertRequests?
 (i.e Inserts from others + local inserts?) I have 56/25 
 without doing any local inserts.

Some of your InsertRequest where QR:d by the receiver - Your node sent
them to another node.

 + Is there a timeout on data waiting to be transmitted? My 
 node seems to
 get to approx 100KiB waiting and then everything stops 
 changing on the Messages transferred display. The data 
 waiting goes up and down about 5Kib, indicating something is 
 happening, but none of the message counts change.
 
 + How long until references are removed? Some of my Routing Table
 entries still contain more than rtMaxRefs entries after 48 
 hrs. Do they stay until the node is dropped from the routing table?

Hmm.. Did you decrease your rtMaxRefs value in order to make the number
of refs break the boundary?
Usually refs are replaced with new ones when a new one from that node
comes along or so..

 + How long until nodes are dropped from the routing table?

They are never dropped, they are just replaced by other nodes (I think).

 + What causes synchronisation between inbound  outbound 
 bandwidth? Only
 my outbound bandwidth is limited (512/128 cable connection) 
 but inbound quickly stabilises at approx 90% of outbound.

Nothing does it explicitly. A couple of things might cause a
non-explicit sunc though, for instance:
1. If all data your node is sending actually is relayed from other nodes
your outbound bw will never be larger than your inbound one.
2. Your node will usually not send a message unless it receives one and
when it so does it will send at least one message.

Regards
/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support


RE: [freenet-support] Helping with website a little question...

2004-01-15 Thread Niklas Bergh
 Hello,
 
 I'd like to help freenet creating a translated into french 
 website, and also writing so docs or HOWTO etc.

Wonderful

 BTW, I've already written some articles about freenet such as 
 http://www.linuxfrench.net/article.php? id_article=597 but the 
 comments are we dont understand 
 anything on the website or I cant fetch any document etc. 
 That's why I'd like to write some french docs  and translate 
 the web site.
 
 Who should I contact ?
I would suggest the project leader Ian Clarke,
[EMAIL PROTECTED] He will most likely read your mail very soon.
:)

Who is maintaining the website ?
No-one and everyone

 Is the website maintained through a CVS  ?

It is.

 Otherwise, a little technical question. My node is _always_ 
 overloaded (due  to BW limit 128Kb/s), and my routing table 
 knows only 50 other nodes even after some days of uptime. Do 
 I have a problem with my node, or others have also these kind 
 of values ?

Nope, that is perfectly normal.. The overload issue is beeing worked on
continously and 50 is the default configuration value for how many other
nodes the node should try to route to.

/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support


RE: [freenet-support] New node not working...500 server errorfrom 127.0.0.1:8888.

2004-01-15 Thread Niklas Bergh
 I never changed the browser configuration when I went from dial-up to 
 cable. Then again, since it is a Microsoft product, maybe it's going 
 around changing things behind my back and exercising more autonomy 
 than it should. I'll check...
 All there is in LAN settings (which I assume will be used for 
 anything going through the network card, including cable inet) is 
 automatically detect settings. There's a bypass proxy server for 
 local addresses option, but checking it would require taking off 
 automatically detect settings and setting who knows what else to 
 make normal Web browsing work again.

'Automatically detect settings' makes IE hail your ISP for proxy
configuration and thereafter use the proxy the ISP gives you back for
every single web page you are fetching from the net... Seems that the
problem here is that your ISP has a broken automatic configuration
script. This brokenness causes your  your browser to ask the ISP:s proxy
to fetch a page from itself and then send it to you.. A non-broken
configuration script would make your browser ask your own machine for
the page instead (and that is where it actually resides).

Not using a proxy is 'normal browsing'. 

Just untick the 'automatically detect settings' checkbox and see if you
can browse the web correctly that way.. You can always turn it back on
again if it doesn't.. This feature is mostly used in enterprises, not so
much for home internet connections.

 Why on earth is this proving to be so complicated... *sigh* No other 
 p2p software I've got has had the slightest hiccup associated with 
 the transition to cable -- the speed boost and stabler connections 
 are all they seem to notice. :)

Try accessing BearShares localhost web interface for instance.. Same
thing ought to happen

 Also, browsing locally hasn't been affected before, now that I think 
 of it. Several things on my system have documentation in plain-jane 
 HTML, notably GTKRadiant, and those render OK in IE. Seems like it 
 has no problem with static local content, only local services on 
 loopback?

Most of those documentation page doesn't come with a web server serving
them..
The problem has nothing to do with the actual content but rather with
how it is delivered to the browser
If the url is something like file:///yyy/zz.html the files are read
directly from your local drive
If the url is something like http:///yyy/zz.html the files are
requested from a web server running on machine ''
The proxy settings in IE only applies to http server connections.

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support


RE: [freenet-support] Stable build 5055 crashes under Linux

2004-01-14 Thread Niklas Bergh
Yup. This means that the newest item in your datastore has a timestamp
that is larger than what your current system clock says the time is.

Have you modified the clock on the machine or similar recently?

I recommend that you locate those files in your ds that is timestamped
in the future and reset their timestamps to now (touch maybe). Or.. If
it only is a matter of minutes.. Restart the node after those minutes
have passes.

/N

 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of 
 Justin The Cynical
 Sent: den 13 januari 2004 09:56
 To: [EMAIL PROTECTED]
 Subject: [freenet-support] Stable build 5055 crashes under Linux
 
 
 *sigh*
 
 I got the message about the new build and the reports that 
 it's faster than the older builds.  Yippie!
 
 So, I run update.sh, delete the old freenet.log, touch it, 
 and start the following command as nobody:
 
 sh start-freenet.sh ; tail -f ./freenet.log
 
 And here is what I find in my log:
 
 Jan 14, 2004 12:34:20 AM (freenet.node.Main, main, NORMAL): 
 Starting Freenet (Fred) 0.5 node, build #5058 on JVM Sun 
 Microsystems Inc.:Java
 HotSpot(TM) Client VM:1.4.2_03-b0 2
 Jan 14, 2004 12:34:22 AM (freenet.node.Main, main, NORMAL): 
 loading node
 keys: node Jan 14, 2004 12:34:22 AM (freenet.node.Main, main, 
 NORMAL): Read node file Jan 14, 2004 12:34:23 AM 
 (freenet.node.Main, main,
 NORMAL): starting filesystem Jan 14, 2004 12:34:26 AM 
 (freenet.node.Main, main, ERROR): Unexpected Exception: 
 freenet.fs.dir.DirectoryException freenet.fs.dir.DirectoryException:
 Clock skew
 at
 freenet.fs.dir.NativeFSDirectory.verifyList(NativeFSDirectory.
 java:2042)
 at freenet.fs.dir.NativeFSDirectory.init(NativeFSDirectory.java:943)
 at freenet.node.Main.main(Main.java:684)
 
 Obviously, it's not going any further.  Any ideas?
 
 Justin
 ___
 Support mailing list
 [EMAIL PROTECTED] 
 http://news.gmane.org/gmane.network.freenet.su pport
 

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support


[freenet-support] Stable build 5052

2004-01-09 Thread Niklas Bergh
Freenet stable build 5052 is now available.

Changelog:
* tfAbsoluteMaxThreads config parameter added.
  tfAbsoluteMaxThreads will allow you to limit maximum number of
  threads the YThreadFactory will spawn. Default value is 500 threads.
  This solves at least some of the OutOfMemoryError:s people are
encountering.

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support


RE: [freenet-support] Freenet under Linux issues

2003-12-11 Thread Niklas Bergh
 On Wed, 10 Dec 2003 10:54:24 +0100
 Niklas Bergh [EMAIL PROTECTED] wrote:
 
   Also, when I try clicking on Spread Freenet, I get a blank
   page that says nothing more than 'Error'.  ??
   
   Justin
  
  Does the link take you to an URL which seems right?
 
 It doesn't show me anything but that word, no links or URL's.

Bah.. I didn't ask about the page.. I asked about the URL (it can
usually be seen in the 'Address' field of the browser).

Alternatively, chek where the link you click to get to the distrubution
page lead to? This is displayed by most browsers somewhere when you
hover the mouse.

 The windows version doesn't seem to understand that I set the 
 ini to make it a perm node, so it refuses to even try. 

Maybe it cannot? Have you configured the Ipaddress properly if you are
NAT:ed? Have you read what it says in the log?

/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support


RE: [freenet-support] multiple nodes inside a NAT network??

2003-12-11 Thread Niklas Bergh
 Just curious as to the logistics of multiple nodes behind a 
 NAT'ed firewall.  I can have each of them have different 
 listen ports and forward the ports to the correct node, but 
 what will nodes outside the network think of multiple nodes 
 to the same IP?  Will the nodes in the network learn to talk 
 to each other dirrectly?  Will there be any proformance impact?
 
 Thanks!

It ought to work just fine.. The network definitely has nothing against
multiple nodes seemingly running on the same host.

Your nodes will talk to each other through the NAT firewall (assuming is
manages to route the connections correctly.. It should do that). Not
much of a performance penalty should come from this.

/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support


RE: [freenet-support] node references

2003-12-11 Thread Niklas Bergh
i am updating my node references. the message says this should only
take a minute. It
has been saying that for over ten minutes now . is that normal?

Nope.. Try downloading the seednodes.ref file manually from
http://freenetproject.org/snapshots/seednodes.ref

Put it in the 'Freenet' folder on your harddrive and restart the node to
make use of it.

/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support


RE: [freenet-support] number of connections + question about node refs

2003-12-11 Thread Niklas Bergh
 I've limited the amount of connections my node can make to 
 50.  I don't know 
 how this effects the network, how it effects my node's 
 ability find files or 
 anything, all I know is this keeps freenet from eating all of 
 my system's 
 resources.  Please tell me if their is a better way.

What kind of resources? Memory, CPU or bandwidth?

The main argument for allowing more connections to be open is that it is
very expensive (CPU-wise) to open a new connection.. If you allow for
more connections to stay open then less connections will need to be
opened.

Also.. You should never allow less than 2*50 connections if you are
running with the default routing table size since the node needs to be
able to keep two connections open per entry in the rt.

/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support


RE: [freenet-support] Freenet under Linux issues

2003-12-10 Thread Niklas Bergh
 Also, when I try clicking on Spread Freenet, I get a blank 
 page that says nothing more than 'Error'.  ??
 
 Justin

Does the link take you to an URL which seems right?

/N

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support


RE: [freenet-support] Is there a user forum anywhere

2003-12-09 Thread Niklas Bergh
Or come visit in #freenet on irc.freenode.net

/N

 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of 
 [EMAIL PROTECTED]
 Sent: den 8 december 2003 21:30
 To: [EMAIL PROTECTED]
 Subject: Re: [freenet-support] Is there a user forum anywhere
 
 
  Is there an English language forum anywhere on the WWW (or 
 elsewhere)
  where Freenet users can assist each other?
  
  That might be too anonymity-compromising for a lot of 
 users. Why not 
  use
  Frost or maybe IIP?
 
 For those who don't mind non-anonymous communication (and 
 have an account on Livejournal), there's a newly-created 
 freenet community on there:
 
http://www.livejournal.com/userinfo.bml?user=freenet

-- 
 9:28PM  up 21 days, 28 mins, 2 users, load averages: 0.24, 0.29, 0.26

Every non-empty totally disconnected perfect compact metric space is
homeomorphic to the Cantor set.
___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support

___
Support mailing list
[EMAIL PROTECTED]
http://news.gmane.org/gmane.network.freenet.support


RE: [freenet-support] Insert file by URI

2003-12-02 Thread Niklas Bergh
Yes, it is a known one that hasn't been fixed yet

/N

-Original Message-
From: [EMAIL PROTECTED]
[mailto:[EMAIL PROTECTED] On Behalf Of Hiu Sing Ngai
Sent: den 2 december 2003 11:27
To: [EMAIL PROTECTED]
Subject: [freenet-support] Insert file by URI


Hello,

I'm trying to insert a file to freenet with the webinterface. The
insertion has been successed but no CHK key has returned. Only
freenet:CHK@ has returned. Is this a bug?

Thanks!


Do you Yahoo!?
Free Pop-Up Blocker - Get it now

___
Support mailing list
[EMAIL PROTECTED]
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support


RE: [freenet-support] Instead of getting smarter, My node seems to get dumber

2003-12-01 Thread Niklas Bergh
Steven

When you request a web page or similar from the network your node
selects where to forward that request to. In certain circumstances your
node cannot find a place to send the request on to, that is when you get
that message.

To see the list of other nodes that your node will forward requests to
have a look at
'http://localhost:/servlet/nodestatus/nodestatus.html', if most of
the nodes are blue you will see trouble, if most of the nodes are red
then you might see some trouble.

To weed out any 'bad' nodes from your routing table you have to let your
node run for prolonged periods of time (permanently would be prefered).

Also, since last weekend the network is undergoing severe changes,
probably reinforcing your problems quite a bit.

Btw, are you running the latest build (5046)?

/N

 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of Steven
 Sent: den 1 december 2003 09:42
 To: [EMAIL PROTECTED]
 Subject: [freenet-support] Instead of getting smarter,My node 
 seems to get dumber
 
 
 So far I have completely Demilitarized my computer running 
 the node (placed it 
 outside of my linksys router's firewall), registered an 
 account with dyndns 
 in order to run a permanent node (which finally works) tried 
 stable and 
 unstable releases, and am still having the same problem...  
 When I start my 
 node, some (maybe half) of the links work (they load so fast 
 that i wonder if 
 they are not simply cached on my node already).  When I click 
 dead links i 
 get an error that tells me to try higher HTL's and stuff.  A 
 few hours go by, 
 and I think that things will improve as my node learns more 
 about the 
 network, instead, when I click dead links I get a different 
 error:  Your 
 request couldn't even make it off the node.
 
 I look around at all of the diagnostic information to maybe 
 find out if I was 
 somehow completely cut off from the network, but in the open 
 Connections 
 area, there are like 25 different connections to about 12 
 different IP's.  
 Data is flowing to and from these different nodes, so I know 
 I'm not cut off 
 completely.  my load indicator usually stays between 15 and 
 30, and is 
 usually steady at around 25.  
 
 If I stay connected to the network in this state for long 
 enough, will my node 
 learn enough to once again make requests to other nodes?  
 Do I need to 
 reseed and restart? Is this normal activity for a node?  Is 
 there something 
 obvious that I'm missing?
 
 ___
 Support mailing list
 [EMAIL PROTECTED] 
 http://dodo.freenetproject.org/cgi- bin/mailman/listinfo/support
 

___
Support mailing list
[EMAIL PROTECTED]
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support


RE: [freenet-support] Unable to start after an insert

2003-11-26 Thread Niklas Bergh
What does the log file say?

/N

 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of Thad Eckard
 Sent: den 25 november 2003 19:37
 To: [EMAIL PROTECTED]
 Subject: [freenet-support] Unable to start after an insert
 
 
 I just realized that I think I'm having a problem. I made an 
 insert over the 
 night, woke up and stopped Freenet for about two minutes, 
 then tried to 
 re-start it. Now, Freenet keeps trying to start with no 
 success. The blue 
 arrowhead objects behind the rabbit just keep running up. I'm 
 using 5039.
 
 _
 Groove on the latest from the hot new rock groups!  Get 
 downloads, videos, 
 and more here.  
 http://special.msn.com/entertainment/wiredform usic.armx
 
 
 ___
 
 Support mailing list
 [EMAIL PROTECTED] 
 http://dodo.freenetproject.org/cgi- bin/mailman/listinfo/support
 

___
Support mailing list
[EMAIL PROTECTED]
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support


RE: [freenet-support] Negative Local Ports

2003-11-20 Thread Niklas Bergh
That are supposed to build up until the maximum connection limit is
reached.. At that point they will start to get dropped whenever a new
connection arrives.. Can this be the cause of what you are seeing?

/N

 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of 
 Richard Thomas Harrison
 Sent: den 20 november 2003 09:29
 To: [EMAIL PROTECTED]
 Subject: Re: [freenet-support] Negative Local Ports
 
 
 -BEGIN PGP SIGNED MESSAGE-
 Hash: SHA1
 
 Niklas Bergh randomly hit the keyboard and managed to write 
 on 19/11/2003 09:21:
 
 | Btw. This should now be 'fixed' in latest cvs. Textual descriptions 
 | will be displayed instead of those negative numbers.
 
 So it does (unstable 6342). However, they don't close and 
 build up. I have sent a very large file to this list (about 
 230k) about this. Unsurprisingly it has been held back for 
 approval before being posted (or not) to this list.
 
 Richard
 - --
 - 
 --
 --
 CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCGCGCACTTATGCCTCAATAGATC
 TGCCACATCG
 CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGAAGTGTGGCATCCT
 TTTGCTTCAG
 dna.pl v0.2.4 (c) 20020613  (tm) rich at 
 mibnet.plus.com
 -BEGIN PGP SIGNATURE-
 Version: GnuPG v1.2.3-nr1 (Windows XP)
 Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org
 
 iD8DBQE/vHs9DehCPPrjI9gRAt/aAJ0Y6KfxjJdS2wptO1QmzE6fDtprxwCfVF5L
 T2ZD61GcG8UERF4tJjpKTZ8=
 =WmTa
 -END PGP SIGNATURE-
 
 
 
 -- 
 **
 **
 This message has been swept clean of viruses by
 AVG Anti Virus email Scanner.
 
http://www.grisoft.com/html/us_index.cfm

Checked by AVG anti-virus system (http://www.grisoft.com).
Version: 6.0.541 / Virus Database: 335 - Release Date: 16/11/2003

___
Support mailing list
[EMAIL PROTECTED]
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support

___
Support mailing list
[EMAIL PROTECTED]
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support


RE: [freenet-support] Negative Local Ports

2003-11-19 Thread Niklas Bergh
Btw. This should now be 'fixed' in latest cvs. Textual descriptions will
be displayed instead of those negative numbers.

/N

 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of Niklas Bergh
 Sent: den 19 november 2003 10:07
 To: [EMAIL PROTECTED]; [EMAIL PROTECTED]
 Subject: RE: [freenet-support] Negative Local Ports
 
 
 These are a programmatical thingy.. They tend to mean that 
 something is wrong with the connection in question.. Maybe 
 not fully opened yet.. Maybe on its way to closing.
 
 Check the mailing list archives for an exact description.
 
 /N
 
  -BEGIN PGP SIGNED MESSAGE-
  Hash: SHA1
  
  For sometime now (3 or 4 weeks I think) I have been noticing
  -ve Local Port numbers being reported in the Open Connection 
  Manager screen (Connection Mode).
  
  It does not seem to be associated with the remote node build
  since atm I have 3 connections to a node, 2 with -ve numbers 
  and 1 with a +ve number.
  
  I might add that I have 67 other connections to other nodes
  before you have a heart attack. All other Local Ports are in 
  the range of 3000 to 5000. The negative Local Port number is 
  -5 for both.
  
  Just rechecked and all 3 connections to the node are now -5.
  
  C:\USR\LOCAL\Freenet0.5
  [\\VIXEN\Richard]$ ver
  
  Microsoft Windows XP [Version 5.1.2600]
  
  C:\USR\LOCAL\Freenet0.5
  [\\VIXEN\Richard]$ java freenet.Version
  Freenet: Fred 0.6 (protocol 1.47) build 6339 (last good build: 6280)
  
  C:\USR\LOCAL\Freenet0.5
  [\\VIXEN\Richard]$ java -version
  java version 1.4.2_01
  Java(TM) 2 Runtime Environment, Standard Edition (build
  1.4.2_01-b06) Java HotSpot(TM) Client VM (build 1.4.2_01-b06, 
  mixed mode)
  
  Will install 6340 and check with that. Probably take some
  time to spot it though as it doesn't happen very often.
  
  Richard
  - --
  -
  --
  --
  CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCGCGCACTTATGCCTCAATAGATC
  TGCCACATCG
  CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGAAGTGTGGCATCCT
  TTTGCTTCAG
  dna.pl v0.2.4 (c) 20020613  (tm) rich at 
  mibnet.plus.com
  -BEGIN PGP SIGNATURE-
  Version: GnuPG v1.2.3-nr1 (Windows XP)
  Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org
  
  iD8DBQE/uzFyDehCPPrjI9gRAhVdAJ4vKRMTQxApFfHGEnB38web3aOAgQCfb5N+
  9PrmpUDUqEeAPgXapjUw6Pk=
  =Qpl2
  -END PGP SIGNATURE-
  
  
  
  --
  **
  **
  This message has been swept clean of viruses by
  AVG Anti Virus email Scanner.
  
 http://www.grisoft.com/html/us_index.cfm
 **
 **
 Checked by AVG anti-virus system (http://www.grisoft.com).
 Version: 6.0.541 / Virus Database: 335 - Release Date: 15/11/2003
 
 ___
 Support mailing list
 [EMAIL PROTECTED] 
 http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/suppor
t

___
Support mailing list
[EMAIL PROTECTED]
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support

___
Support mailing list
[EMAIL PROTECTED]
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support


Re: [freenet-support] Freenet Stable Build 5039

2003-11-19 Thread Niklas Bergh
Or.. as NGR would do it.. Hmmm.. that node is one slow sucker.. better send
the query to another one next time.

/N
- Original Message - 
From: TLD [EMAIL PROTECTED]
To: [EMAIL PROTECTED]
Sent: Wednesday, November 19, 2003 6:07 PM
Subject: Re: [freenet-support] Freenet Stable Build 5039


  This build turns off rejecting queries based on output bandwidth usage,
  a feature that is unnecessary (we have other ways of limiting bandwidth
  usage) and counterproductive to routing.

 Maybe so, but I doubt having a Data waiting to be transmitted value
above
 30 minutes worth of transmission (with full bandwidth usage) is good for
 the routing, either.
 I noticed the value notably lower in the latest builds (in the order of
 5-10 minutes) with the bandwidth usage-based queryreject; I hope things
 won't get Mighty Bad again :)


 Might a I have the key you need but my band is full and can't send it
 right now, try searching with the other nodes meanwhile and come back
later
 if you really need it message help such situation?

 -- 
 /~\ The ASCIITLD
 \ / Ribbon Campaign They that can give up essential liberty to obtain
   X  Against HTMLa little temporary safety deserve neither liberty
 / \ Email!  nor safety. -- Benjamin Franklin



 ___
 Support mailing list
 [EMAIL PROTECTED]
 http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support


___
Support mailing list
[EMAIL PROTECTED]
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support


Re: [freenet-support] Beginner... all I get isWaitingfor127.0.0.1... ...follow-up

2003-11-17 Thread Niklas Bergh
 3. I'm behind a software firewall, and have set local host to the
 firewall IP, with port forwarding to my machine. Is that correct?

Do you mean the configuration parameter named IPAddress?  (I don't
know if windows users see the actual parameter names or not).

Or have you set 'localhost' to the firewall IP in your 'host' file? If so...
change it back, it should never ever point to another machine..

/N

___
Support mailing list
[EMAIL PROTECTED]
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support


Re: [freenet-support] Can't receive any Freenet data

2003-11-15 Thread Niklas Bergh
Actaully, this might be caused by a bug releated to seednodes reading which
is solved in build 5033 (the absolute newest one)..

Could you try upgrading to that build and also download
http://freenetproject.org/snapshots/seednodes.ref and replace your local
seednodes.ref file with this one...

regards
/N

- Original Message - 
From: [EMAIL PROTECTED]
To: [EMAIL PROTECTED]
Sent: Saturday, November 15, 2003 2:58 AM
Subject: Re: [freenet-support] Can't receive any Freenet data


  This is sadly a common first user situation.
  Exactly what happened? Did you try to fetch the links on the Web
  Interface page? Even under ideal conditions a node takes a while to
  become fully functional (current estimates are around 24 hours for a
  node to be reasonably useful).

 24 hours are a long time for just a single connection.
 I allways get the following error:

 Couldn't Retrieve Key
 Couldn't connect to the network. Are you sure you have configured Freenet
 correctly? Also make sure that you are connected to the internet.

 when trying to connect to a freenet link like:

http://127.0.0.1:/[EMAIL PROTECTED]/TFE//?htl=15try=3



  I note that you haven't showed the external internet address of the
  router. Did you add it to the freenet.conf file?:
  ipAddress=82.65.12.3
  or
  ipAddress=amphibian.dyndns.org
  [ using dyndns is a common solution for such setups, they are a free
  dynamic DNS provider, www.dyndns.org ]


 I didn't showed it because the external ip changes allways automatically
 after the login to my ISP.
 I just started the router and then i used the IP the router get from the
ISP
 after the login in the freenet.conf file, after editing the freenet.conf
file
 with the new ip i started freenet.


 
  Also, did you remove the % at the beginning of the line?

 No sorry i forgot it.
 But i removed it a few minutes ago and tried it again but still no
success.
 I still get the above mentioned error message.
 Do i really have to wait 24 hours for the first connection success
message?


 
   Those are the iptables firewall rules i used for accesing freenet:
   iptables -A FORWARD -j ACCEPT -o ppp0 -p tcp \
   -s 192.168.100.8 --sport 1024: --dport 23030 -m state
   --state NEW,ESTABLISHED,RELATED
  
   iptables -A FORWARD  -j ACCEPT -i ppp0 -p tcp \
   --sport 23030 -d 192.168.100.8 -m state --state
   ESTABLISHED,RELATED
  
   iptables -t nat -A PREROUTING -i ppp0 -p tcp --dport 23020 -j DNAT
   --to-dest 192.168.100.8
 
  Ok. Tell me your IP address and I will check connectivity. Or come to
  #freenet on irc.freenode.net, we will see if we can help you.

 Ok i just tested on the Shield UP website (a port scanner -
http://grc.com/ )
 if the port 23030 is open.
 The results where:

 Port: 23030
 Status: Open
 Protocol and Application: Unknown Protocol for this port
 Unknown Application for this port

 Seems to me that this is working.



 
  I do not know if it is a firewall rules problem. Check the Open
  Connections page, do you have incoming connections?

 No, the Open Connection page shows the following:

 Connections open (Inbound/Outbound/Limit) 0 (0/0/512)
 Connections transferring (Receiving/Transmitting) 0 (0/0)
 Bytes waiting to be sent None

 Best Regards,
   Oliver C.

 ___
 Support mailing list
 [EMAIL PROTECTED]
 http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support


___
Support mailing list
[EMAIL PROTECTED]
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support


Re: [freenet-support] freenet load always 100%

2003-11-12 Thread Niklas Bergh
 I'm not seeing this but now that the world seems to have discovered my
node,
 my JVM keeps dying with out-of-memory and NULL pointer exceptions.  I
still
 have plenty of (virtual) memory left, so something else must be serving as
a
 cap on the memory that java can get.

 This might be a java tuning parameter or a kernel setting (I'm using
FreeBSD
 4.9-STABLE), but if anybody has any clues I'm appreciate it.  My current
 solution of shutting down freenet every time it happens and restarting
it
 is getting old fast especially since that's getting to be about every hour
 now.

OOM:s usually causes NPE:s as a side effect. To allow java to use more
memory spawn your node with something like 'java -Xmx256M XX'. Depending
on which JVM version you are running the default maximum amount of memory
the JVM will use is either 64 or 128 megs which is usually too little memory
for a popular node to work well.

/N

___
Support mailing list
[EMAIL PROTECTED]
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support


RE: [freenet-support] Re: route not found

2003-11-06 Thread Niklas Bergh
 To fix this, I've enabled all outgoing packets for all programs in 
 ZoneAlarm (expert rules), but I'm afraid this may not be the 
 best idea 
 from a security point of view.

Well.. It isn't good from that point of view if you suffer from problems
with trojans and other stuff (=you run stuff on your computer that you
don't know that you do).. It makes no difference for otherwise.


/N

___
Support mailing list
[EMAIL PROTECTED]
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support


Re: [freenet-support] Re: 5029 overloads

2003-11-01 Thread Niklas Bergh
 I am using YThreadFactory (obviously) and maximumThreads=300.  Also, I'm
 allocating 128MB to java memory.  I'll keep it running until the
 outgoing bandwidth gets really low.

 Recommendations?  Or does this indicate a bug needing to be fixed?

 -Martin

Given the amount of requests your that your node receive 128M probably isn't
enough Try for a while with 192M or so.

Well, Muxing and SIPv2 will both lead to decreased memory usage. Muxing will
affect memory useage directly due to decreased amount of connections while
SIPv2 will lead to decreased CPU which probably will cause some memory
savings due to decreased enqueueing of stuff.

/N

___
Support mailing list
[EMAIL PROTECTED]
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support


RE: [freenet-support] Rantsies

2003-10-29 Thread Niklas Bergh

  Good to hear. Wonder if it is because of working NGR or 
 simply because 
  the unstable network is smaller.. I believe that this isn't 
 known yet.
 Don't things work better when it's bigger? :-)

It should do.. If routing was working well and able to cope with the
growth and load balancing.

  Hmm.. Well.. Actually they both speak exactly the same 
 language.. The
 Then, no reason why 'stable' couldn't actually talk well with 
 other stable 
 nodes and ngr ones?  And just keep the unstable only dealing 
 with ngr for 
 testing?

As of yesterday there where three types of nodes..
Stable, all non-NGR
Unstable, anti-NGR (build 6281)
Unstable, NGR (build 6281+)
The previous two types could talk to each other.. The last type could
only talk to its siblings

  Hmmm.. Not play really.. The intention is to make it work...
 Perception skewers reality.  I don't know WHY unstable works, 
 but I see that 
 it does.  I tested again yesterday with stable (getting new 
 seednodes) and I 
 still couldn't *do* anything. Ie, couldn't retrieve any 
 'known' keys.  So, 
 either all the linked content just isn't there any more on 
 'stable', or 
 something is still broke.  Whether by luck or talent, it 
 seems that they have gotten unstable 'working'.  

Possibly anti-NGR...

  Probabilistic caching.
  Prevent nodes from caching data whose source they aren't 
 routing-wise 
  close to.
 Why? I don't understand this... ideally, shouldn't a node 
 cache *everything* 
 that runs through it, given enough space? 

It does, until the DS is 90% full.. After that it tries to enhance
specialization by selectively accept stuff into its store..
 
  NGR
  Keep track of not only which nodes have what data.. Also 
 keep track of 
  how fast they can supply it.
 Err, um... keep track of what nodes have what data? That 
 doesn't sound like a 
 good idea at all.  Hopefully, you mean, keep track of what 
 nodes can GET 
 what data. I hope, at least, that would be the way it works. 
 No, I don't 
 have the GPL, but I know someone who can get it for ya... I'm 
 just passing 
 your request on...

Right, my mistake..

  Problem #8:
  OCO.
  Massive amounts of CPU is used for connection negotiations due to 
  heavy encryption stuff used in there. OCO amplified this 
 latent issue.
 I read Toad's roadmap, and it seems that at least udp is 
 being considered. 
 Great. This is how it SHOULD be done:  Or, at least, an 
 option.  If you're on 
 lower bandwidth, udp should be fine, no?  And solves having a ton of 
 connections always open.  It'd put more load on the machine, 
 but, probably 
 still acceptable.  

The problem is not the TCP connections.. It is all about FNP connections
(currently over TCP but they would have the same problem even over UDP).
The problem is that two nodes has to autheticate with each other to
verify that the Peer is who he says he is.. This is true no matter if
the underlying transport would be TCP or UDP.

  1. Multiplexing, would allow a single connections to send multiple 
  messages simultaneously thereby enabling us to keep only one single 
  connection open to each node, compared to keeping one free 
 connection 
  the each node.
 Ah, so THAT is why I see so multiple instances of a node in 
 the OC window? 
 Because this is yet to be done? 

Yep.

  If someone wants to add missing things to the list then 
 feel free to 
  do so.
 That's a pretty nice list, and certainly gives me a new perspective. 

Good, that was the intention :)
There is no play involved.. Most everything is done for a quite good
reason :)

  Nahh.. They don't really dismiss it.. They just want things 
 to start 
  working at all first :) Any help would be very appreciated.
 I think they're doing a good job with unstable.  It just is 
 non-intuitive 
 that your best hope is NOT to get the stable release: I think 
 it'd be helpful 
 for the main page to reflect that unstable isn't really so 
 much 'broken' as 'in need of constant update'.  Meaning, if 
 you are downloading the latest build each day, chances are 
 you're probably be better off than downloading the stable at 
 all.  But, that's just my experience so far.

Usually stable is the best hope.. It is just that here has been a rough
couple of months lately..

/N

___
Support mailing list
[EMAIL PROTECTED]
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support


RE: [freenet-support] Help Respond Soon

2003-10-29 Thread Niklas Bergh
What kind of error messages do you see?

And also are you using some kind of broadband router/software firewall

/N

 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of Red Dem0n
 Sent: den 25 oktober 2003 23:39
 To: [EMAIL PROTECTED]
 Subject: [freenet-support] Help Respond Soon
 
 
 I've been trying to get this Freenet to load the websites but 
 its not doing it at all. I have been leaving it on for a long 
 time now.
 
 Right now I have 2.40ghz, 768DDRRAM, and cable modem.
 
 I would like to know what I should set my settings to so I 
 can get the best results possible and make the pages load 
 more faster, because I havent been able to get any to load 
 except the main page which takes forever to load the little images.
 
 
 ___
 Support mailing list
 [EMAIL PROTECTED] 
 http://dodo.freenetproject.org/cgi- bin/mailman/listinfo/support
 

___
Support mailing list
[EMAIL PROTECTED]
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support


RE: [freenet-support] browser

2003-10-29 Thread Niklas Bergh
Title: Message



How about 
using the 'Address' field then? I allows you to navigate to ANY web page in the 
whole wide world.

Also, you can 
type in any start page you want in 'Tools\Internet Options\Home page'. If that 
doesn't work then I would suggest that you have a talk with Microsoft. And if 
you cannot remember the address of your previous 'Earthlink' start page then I 
suggest you have a talk with Earthlink.

/N

  
  -Original Message-From: 
  [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] 
  On Behalf Of Robert GreenageSent: den 29 oktober 2003 
  15:08To: [EMAIL PROTECTED]Subject: 
  [freenet-support] browser
  
  freenet has co opted my browser. when i log on to the net my browser 
  would default to my ISP(earthlink) homepage.now it defaults to 127.0.0.1:. 
  i cannot get it to go to any other website. even by using favorites or 
  history. the default browser for earthlink is IE 6.0. this also happens to be 
  how i access my mail. any ideas?
  
  
  --- Robert Greenage
  --- [EMAIL PROTECTED]
  --- EarthLink: It's your Internet.
  
  
___
Support mailing list
[EMAIL PROTECTED]
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support

RE: [freenet-support] Re: Support Digest, Vol 3, Issue 38

2003-10-29 Thread Niklas Bergh
Hmm.. Ok, so what exacltly is it that doesn't work for you? Is it
getting the ActiveLinks in the web interface? Is it navigating to a
freesite? If it is the second then you should get a message saying
something like 'Route not found' or possibly 'Data not found' or
something.. What does the page you get say?

/N

 -Original Message-
 From: [EMAIL PROTECTED] 
 [mailto:[EMAIL PROTECTED] On Behalf Of Red Dem0n
 Sent: den 29 oktober 2003 16:02
 To: [EMAIL PROTECTED]
 Subject: [freenet-support] Re: Support Digest, Vol 3, Issue 38
 
 
 I don't see any error messages at all, I figured maybe it was 
 something due to the uptime of the program so i kept it on 
 about 10-12 hours, and the only difference I saw was that 
 when I started Freenet it was at a load of 100%, after the 
 10-12 hours it was at a load of 0%.  So I'm guessing there 
 might be something wrong with the settings, although it is 
 under the default settings at the moment.  There's no 
 router/software firewall I have right now so that couldnt be 
 the issue.
 
 
 
  Message: 5
  Date: Wed, 29 Oct 2003 10:54:30 +0100
  From: Niklas Bergh [EMAIL PROTECTED]
  Subject: RE: [freenet-support] Help Respond Soon
  To: [EMAIL PROTECTED]
  Message-ID: [EMAIL PROTECTED]
  Content-Type: text/plain;   charset=us-ascii
 
  What kind of error messages do you see?
 
  And also are you using some kind of broadband 
 router/software firewall
 
  /N
 
  -Original Message-
  From: [EMAIL PROTECTED]
  [mailto:[EMAIL PROTECTED] On Behalf Of Red Dem0n
  Sent: den 25 oktober 2003 23:39
  To: [EMAIL PROTECTED]
  Subject: [freenet-support] Help Respond Soon
 
 
  I've been trying to get this Freenet to load the websites 
 but its not 
  doing it at all. I have been leaving it on for a long time now.
 
  Right now I have 2.40ghz, 768DDRRAM, and cable modem.
 
  I would like to know what I should set my settings to so I can get 
  the best results possible and make the pages load more faster, 
  because I havent been able to get any to load except the main page 
  which takes forever to load the little images.
 
 
  ___
  Support mailing list
  [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi- 
  bin/mailman/listinfo/support
 
 
 
  --
 
 
 ___
 Support mailing list
 [EMAIL PROTECTED] 
 http://dodo.freenetproject.org/cgi- bin/mailman/listinfo/support
 

___
Support mailing list
[EMAIL PROTECTED]
http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support


RE: Longtime idle connections, was: [freenet-support] Build 659 (unstable)

2003-02-12 Thread Niklas Bergh
And here comes the third dump of the ocm contents

155.239.180.179:34467 0 0 yes 1 0 572922365 QThread-12740 Inbound 33c0b6
80.134.237.85:21321 0 0 yes 2 0 533401428 QThread-25929 Inbound 7e5c44
80.134.237.85:15291 0 0 yes 8 0 484932664 QThread-34344 Inbound 5e833f
68.82.148.48:18230 0 0 yes 1 0 450711357 QThread-36576 Inbound 514847
129.240.200.147:39076 1 147772 yes 471 0 198812426 QThread-45337 Inbound
3c54ad
66.28.14.56:4732 1 1021207 yes 1740 0 173207288 QThread-45442 Inbound
6a5180
210.86.48.242:44180 0 0 yes 1 0 106259012 QThread-45049 Inbound f955a
134.193.75.29:3277 0 0 yes 11 0 198269616 QThread-45215 Inbound 1423d4
216.87.102.230:2816 0 0 yes 8 0 73175861 QThread-45395 Inbound 4e23b2

Please note that the same connections are still there.. plus some
newcomers. The send-queue-size 147772 is also stalled (haven't changed
in a couple of hours)

Summary of current connections:
Number of open connections: 120
Number of outbound connections: 1
Number of inbound connections: 119

Routing time status:
# Current routingTime: 0ms.
# Active pooled jobs: 276 (92.0%)   [QueryRejecting all incoming
requests!] 

Threadcount (maximumthreads is set to 300...):
Total pooled threads 349
Available pooled threads 74
Pooled threads in use 275

And yes.. The node is just about idle now.. 

A couple of strange things I note though..
1. The node is not *completely* idle.. There seems to be one or two
threads that are still making themselves useful, accepting an incoming
connection now and then and establishing a new outgoing connection once
in a while. I assume that given enough time they will also be stuck
however...

2. For some really strange reason: 'Local mean traffic (queries per
hour) : 19399.68744947998'. This CANNOT BE TRUE.. My node is definitely
not serving up any 20kQueries/h, close to no processor or bandwidth is
used. Is the open-but-idle connections counted into this value for some
reason?!

/N






-Original Message-
From: Matthew Toseland [mailto:[EMAIL PROTECTED]] 
Sent: den 11 februari 2003 10:02
To: Niklas Bergh
Subject: Re: Longtime idle connections, was: [freenet-support] Build 659
(unstable)


On Tue, Feb 11, 2003 at 09:52:17AM +0100, Niklas Bergh wrote:
 
 
 -Original Message-
 From: Matthew Toseland [mailto:[EMAIL PROTECTED]]
 Sent: den 10 februari 2003 19:55
 To: Niklas Bergh
 Subject: Re: [freenet-support] Build 659 (unstable)
 
 
 On Mon, Feb 10, 2003 at 11:38:09AM +0100, Niklas Bergh wrote:
  659 seems to have solved the 'Node suddenly ceases traffic'-problem.

  I
 
  have a node that has been up for close 120 hours now and there is 
  till
 
  no sign of stagnation. It is serving up 13000 q/h at about 1MBit/s.
 
 Yay. 1Mbps _both ways_ ?
 
 Nope, summed up. Most of it (80% or so) is outgoing traffic.
 
 
  
  One thing though:
  
  Peer addr Send Count Send Size Receiving Messages Idle time Lifetime
  Thread Type ID 155.239.180.179:34467 0 0 yes 1 0 393188783 
  QThread-12740 Inbound 33c0b6 80.134.237.85:21321 0 0 yes 2 0
353667846
 
  QThread-25929 Inbound 7e5c44 80.134.237.85:15291 0 0 yes 8 0 
  305199082
 
  QThread-34344 Inbound 5e833f 68.82.148.48:18230 0 0 yes 1 0 
  27095
  QThread-36576 Inbound 514847 213.208.127.216:17565 0 0 yes 7 0 
  172335455 QThread-44615 Inbound 134183 64.252.121.1:34381 0 0 yes 10
0
 
  22933808 QThread-45372 Inbound 323c46 216.15.192.235:56589 0 0 yes 2

  0
 
  42376945 QThread-42938 Inbound 13374f 134.193.75.29:3277 0 0 yes 8 0
  18536034 QThread-45215 Inbound 1423d4 129.240.200.147:39076 1 147772

  yes 471 0 19078844 QThread-45337 Inbound 3c54ad
  
  This is the initial entries of my ocm table. I do not like that
  idle-time always is zero on those connections where 'receiving' is 
  'yes'. It seems like the idletime is set to zero even if the 
  connection is idle. Should it really be so, couldn't idle-time be
set 
  to indicate the time since the last packet was recieved on that 
  connection instead?!
 
 Err... hmm. It is transferring a message with trailing fields i.e. a
 file. This can take a long time, but it is not idle during that 
 time...
 
 Is the idle time specified in milliseconds? In that case, over the 
 first connection, one message in 109 hours
 
 OCM 24 hours later:
 
 Peer addr Send Count Send Size Receiving Messages Idle time Lifetime 
 Thread Type ID 155.239.180.179:34467 0 0 yes 1 0 470074608 
 QThread-12740 Inbound 33c0b6 80.134.237.85:21321 0 0 yes 2 0 430553671

 QThread-25929 Inbound 7e5c44 80.134.237.85:15291 0 0 yes 8 0 382084907

 QThread-34344 Inbound 5e833f 68.82.148.48:18230 0 0 yes 1 0 347863600 
 QThread-36576 Inbound 514847 213.208.127.216:17565 0 0 yes 7 0 
 249221280 QThread-44615 Inbound 134183 134.193.75.29:3277 0 0 yes 8 0 
 95421859 QThread-45215 Inbound 1423d4 129.240.200.147:39076 1 147772 
 yes 471 0 95964669 QThread-45337 Inbound 3c54ad
 66.28.14.56:4732 1 1021207 yes 1740 0 70359531 QThread-45442 Inbound
6a5
 
 Please note that this is the same connections as yesterday

RE: [freenet-support] Build 659 (unstable)

2003-02-12 Thread Niklas Bergh
JVM 1.4.1_01 (always and ever until there is a newer one)

-Original Message-
From: [EMAIL PROTECTED]
[mailto:[EMAIL PROTECTED]] On Behalf Of Matthew Toseland
Sent: den 6 februari 2003 19:48
To: [EMAIL PROTECTED]
Subject: Re: [freenet-support] Build 659 (unstable)


Are you sure you aren't using a nonstandard JVM? The IBM JVM has been
known to have serious problems, as has Kaffe, and old versions of the
Sun one sometimes have nasty bugs..

On Thu, Feb 06, 2003 at 10:26:25AM +0100, Niklas Bergh wrote:
 659 would seem to have some problems with announcing. One of the nodes

 I upgraded yesterday hasn't done a single usefult thing since...
 
 
 Feb 4, 2003 5:39:20 PM (freenet.node.states.maintenance.Checkpoint,
 QThread-4): Executing Checkpoint: Native Filesystem Directory 
 checkpoint Feb 4, 2003 5:39:21 PM 
 (freenet.node.states.maintenance.Checkpoint,
 QThread-4): Executing Checkpoint: Autodetection of IP addresses
 Feb 4, 2003 5:39:31 PM (freenet.node.states.maintenance.Checkpoint,
 QThread-4): Executing Checkpoint: Autodetection of IP addresses
 Feb 4, 2003 5:39:31 PM
(freenet.node.states.announcing.SendAnnouncement,
 QThread-6): Sending NodeAnnouncement failed:
 freenet.ConnectFailedException: Against peer DSA(eda1 570b d062 a746
 1a54  e1cf 2800 9cf4 250f 5328) @ 193.11.247.167:61608 - Cannot
connect
 to: 193.11.247.167:61608 (terminal)
 Feb 4, 2003 5:39:32 PM
(freenet.node.states.announcing.SendAnnouncement,
 QThread-6): Sending NodeAnnouncement failed:
 freenet.ConnectFailedException: Against peer DSA(e3d9 6da2 c70f 7b75
 0ad3  f077 236f bae0 6ed7 7e01) @ 217.215.123.28:19790 - Cannot
connect
 to: 217.215.123.28:19790 (terminal)
 Feb 4, 2003 5:39:32 PM (freenet.OpenConnectionManager, QThread-5):
 Established connection: tcpconnection: 134.147.115.87:26277
 Feb 4, 2003 5:39:34 PM (freenet.node.states.maintenance.Checkpoint,
 QThread-4): Executing Checkpoint: Native Filesystem Directory
checkpoint
 Feb 4, 2003 5:39:39 PM (freenet.interfaces.PublicInterface, Interface
#
 tcp/14166): Accepted connection: tcpconnection: 160.26.102.198:4620
 Feb 4, 2003 5:39:40 PM (freenet.interfaces.FreenetConnectionRunner,
 QThread-4): Inbound connection failed: java.io.EOFException
 Feb 4, 2003 5:39:41 PM (freenet.node.states.maintenance.Checkpoint,
 QThread-4): Executing Checkpoint: Autodetection of IP addresses
 Feb 4, 2003 5:39:44 PM (freenet.interfaces.PublicInterface, Interface
#
 tcp/14166): Accepted connection: tcpconnection: 217.84.0.234:4103
 Feb 4, 2003 5:39:48 PM (freenet.node.states.maintenance.Checkpoint,
 QThread-10): Executing Checkpoint: Native Filesystem Directory
 checkpoint
 Feb 4, 2003 5:39:51 PM (freenet.node.states.maintenance.Checkpoint,
 QThread-10): Executing Checkpoint: Autodetection of IP addresses
 Feb 4, 2003 5:40:00 PM (freenet.node.states.maintenance.Checkpoint,
 QThread-10): Executing Checkpoint: Polling and aggregation of
 diagnostics.
 Feb 4, 2003 5:40:01 PM (freenet.node.states.maintenance.Checkpoint,
 QThread-10): Executing Checkpoint: Autodetection of IP addresses
 Feb 4, 2003 5:40:03 PM (freenet.node.states.maintenance.Checkpoint,
 QThread-10): Executing Checkpoint: Native Filesystem Directory
 checkpoint
 Feb 4, 2003 5:40:03 PM
(freenet.node.states.announcing.SendAnnouncement,
 QThread-6): Sending NodeAnnouncement failed:
 freenet.ConnectFailedException: Against peer DSA(50a8 f534 ea52 f574
 455c  00d9 5f7e e11d 2eb4 4570) @ 134.147.115.87:26277 -
authentication
 timed out (terminal)
 Feb 4, 2003 5:40:03 PM (freenet.node.states.announcing.Announcing,
 QThread-6): Announcement failed to eda1 570b d062 a746 1a54  e1cf 2800
 9cf4 250f 5328 at depth  15.
 Feb 4, 2003 5:40:03 PM (freenet.node.states.announcing.Announcing,
 QThread-6): Announcement failed to e3d9 6da2 c70f 7b75 0ad3  f077 236f
 bae0 6ed7 7e01 at depth  15.
 Feb 4, 2003 5:40:03 PM (freenet.node.states.announcing.Announcing,
 QThread-6): Announcement failed to 50a8 f534 ea52 f574 455c  00d9 5f7e
 e11d 2eb4 4570 at depth  15.
 Feb 4, 2003 5:40:04 PM (freenet.interfaces.FreenetConnectionRunner,
 QThread-4): Inbound connection failed: java.io.EOFException
 Feb 4, 2003 5:40:05 PM (freenet.interfaces.PublicInterface, Interface
#
 tcp/14166): Accepted connection: tcpconnection: 129.116.44.183:33608
 Feb 4, 2003 5:40:11 PM (freenet.node.states.maintenance.Checkpoint,
 QThread-10): Executing Checkpoint: Autodetection of IP addresses
 Feb 4, 2003 5:40:14 PM (freenet.interfaces.PublicInterface, Interface
#
 tcp/14166): Accepted connection: tcpconnection: 217.84.0.234:4141
 Feb 4, 2003 5:40:17 PM (freenet.node.states.maintenance.Checkpoint,
 QThread-6): Executing Checkpoint: Native Filesystem Directory
checkpoint
 Feb 4, 2003 5:40:21 PM (freenet.node.states.maintenance.Checkpoint,
 QThread-6): Executing Checkpoint: Autodetection of IP addresses
 Feb 4, 2003 5:40:31 PM (freenet.node.states.maintenance.Checkpoint,
 QThread-6): Executing Checkpoint: Autodetection of IP addresses
 Feb 4, 2003 5:40:31 PM

Re: Longtime idle connections, was: [freenet-support] Build 659 (unstable)

2003-02-12 Thread Niklas Bergh
I am not totally sure (starting the test today) but I *think* it does. I
remember that I started noticing this problem when I first increased
maxmimumThreads in order to make my node use up more of my available
bandwidth

/N


___
Support mailing list
[EMAIL PROTECTED]
http://hawk.freenetproject.org:8080/mailman/listinfo/support



RE: [freenet-support] Announcement problem

2003-02-11 Thread Niklas Bergh
Nope, that is not it. I am *pretty* sure that this is the way:

When announcing your node will send an announcement message with a
specific HTL to 3 of the nodes in you routing table.. These three will
in their turn distribute the announcement on to the best match in their
routing table.. and so on until the HTL becomes zero.. Much like a plain
insert.


/N

-Original Message-
From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED]] 
Sent: den 11 februari 2003 15:50
To: Niklas Bergh
Subject: RE: [freenet-support] Announcement problem


At 12.53 11/02/03 +0100, you wrote:
I have seen that earlier too but I haven't noticed it for a long time 
now..

I think that if your node has been running earlier and because of that 
is present in other nodes routingtables and thereby recieveing incoming

connections everything should start working because of that...

This is what I find strange; after announcement, I must be in  routing
tables of all nodes that are in my routing table  this is the
supposed way things works, isn't it ?

Ciao.   Marco


/N

-Original Message-
From: [EMAIL PROTECTED]
[mailto:[EMAIL PROTECTED]] On Behalf Of 
[EMAIL PROTECTED]
Sent: den 11 februari 2003 11:36
To: [EMAIL PROTECTED]
Subject: Re: [freenet-support] Announcement problem


At 02.45 11/02/03 -0500, you wrote:
On Mon, 2003-02-10 at 20:07, Greg Wooledge wrote:
 Build 611?  Are you sure about that?  I have made contact with
 (unstable) nodes with build numbers as high as 663.
 
 Are you also seeing your problem with the stable builds?

Sorry for the typo... that should say 661.  Also tried it tonight with
556: no successful announcements, same types of exceptions I included
before.

I don't know if this is significant, but in the last couple of  month 
my fresly bootsrapped node (now stable 552) has no traffic  until I do 
some retrieve with fproxy; then it begin to have  traffic that 
stabilize in a couple of hours.

HTH.   Marco


--
+ il  Progetto Freenet - segui il coniglio bianco+
* the Freenet  Project - follow the  white rabbit*
*   Marco A. Calamari[EMAIL PROTECTED] www.marcoc.it   *
* PGP RSA: ED84 3839 6C4D 3FFE 389F 209E 3128 5698   *
+ DSS/DH:  8F3E 5BAE 906F B416 9242 1C10 8661 24A9 BFCE 822B +
 


___
Support mailing list
[EMAIL PROTECTED] 
http://hawk.freenetproject.org:8080/mailman/listinfo/support

-- 
+ il  Progetto Freenet - segui il coniglio bianco+
* the Freenet  Project - follow the  white rabbit*
*   Marco A. Calamari[EMAIL PROTECTED] www.marcoc.it*
* PGP RSA: ED84 3839 6C4D 3FFE 389F 209E 3128 5698   *
+ DSS/DH:  8F3E 5BAE 906F B416 9242 1C10 8661 24A9 BFCE 822B +
 



___
Support mailing list
[EMAIL PROTECTED]
http://hawk.freenetproject.org:8080/mailman/listinfo/support



FW: [freenet-support] Announcement problem

2003-02-11 Thread Niklas Bergh
Mrgh.. The listserv sets the wrong reply to address in the mails from
this list. Here comes a mail I thought I sent to the list two hours
ago..

/N

-Original Message-
From: Niklas Bergh [mailto:[EMAIL PROTECTED]] 
Sent: den 11 februari 2003 13:01
To: 'bdonlan'
Subject: RE: [freenet-support] Announcement problem


This is the last part of a debug-level log from one of my nodes that are
idle without reason (One that is idle from startup that is.. Not one of
those becoming idle after a number of days).. I can't really find a
reason for the problems from it. If someone is interested in looking
then help yourself ;)

/N



idle66nodeLog.zip
Description: Zip compressed data


FW: Longtime idle connections, was: [freenet-support] Build 659 (unstable)

2003-02-11 Thread Niklas Bergh
And another one

-Original Message-
From: Niklas Bergh [mailto:[EMAIL PROTECTED]] 
Sent: den 11 februari 2003 12:57
To: 'Matthew Toseland'
Subject: RE: Longtime idle connections, was: [freenet-support] Build 659
(unstable)


On this particular node maxmimumThreads are set to 300 so everything is
order from that aspect...

/N


___
Support mailing list
[EMAIL PROTECTED]
http://hawk.freenetproject.org:8080/mailman/listinfo/support



RE: [freenet-support] Build 659 (unstable)

2003-02-10 Thread Niklas Bergh
659 seems to have solved the 'Node suddenly ceases traffic'-problem. I
have a node that has been up for close 120 hours now and there is till
no sign of stagnation. It is serving up 13000 q/h at about 1MBit/s.

One thing though:

Peer addr Send Count Send Size Receiving Messages Idle time Lifetime
Thread Type ID
155.239.180.179:34467 0 0 yes 1 0 393188783 QThread-12740 Inbound 33c0b6
80.134.237.85:21321 0 0 yes 2 0 353667846 QThread-25929 Inbound 7e5c44
80.134.237.85:15291 0 0 yes 8 0 305199082 QThread-34344 Inbound 5e833f
68.82.148.48:18230 0 0 yes 1 0 27095 QThread-36576 Inbound 514847
213.208.127.216:17565 0 0 yes 7 0 172335455 QThread-44615 Inbound 134183
64.252.121.1:34381 0 0 yes 10 0 22933808 QThread-45372 Inbound 323c46
216.15.192.235:56589 0 0 yes 2 0 42376945 QThread-42938 Inbound 13374f
134.193.75.29:3277 0 0 yes 8 0 18536034 QThread-45215 Inbound 1423d4
129.240.200.147:39076 1 147772 yes 471 0 19078844 QThread-45337 Inbound
3c54ad

This is the initial entries of my ocm table. I do not like that
idle-time always is zero on those connections where 'receiving' is
'yes'. It seems like the idletime is set to zero even if the connection
is idle. Should it really be so, couldn't idle-time be set to indicate
the time since the last packet was recieved on that connection instead?!

/N


___
Support mailing list
[EMAIL PROTECTED]
http://hawk.freenetproject.org:8080/mailman/listinfo/support



[freenet-support] Announcement problem

2003-02-08 Thread Niklas Bergh
I just noticed that another of my nodes has suddenly stopped being useful. No 
connections in or out at all currently. Last part of the log:

Feb 8, 2003 8:09:10 AM (freenet.node.states.announcing.Announcing, QThread-1818): 
Found 2 announcement targets for this node.
Feb 8, 2003 8:09:32 AM (freenet.node.states.announcing.Announcing, QThread-1818): 
Announcement failed to d5f6 fcf4 4f77 7b5f dc91  bb7e a31d 0b99 7ddd 2ddf at depth  2.
Feb 8, 2003 8:09:32 AM (freenet.node.states.announcing.Announcing, QThread-1818): 
Announcement failed to 6706 2742 3589 759e 1187  dbe9 66fb 98b0 93f6 0d02 at depth  2.
Feb 8, 2003 8:24:10 AM (freenet.node.states.announcing.Announcing, QThread-1818): 
Found 2 announcement targets for this node.
Feb 8, 2003 8:24:33 AM (freenet.node.states.announcing.Announcing, QThread-1818): 
Announcement failed to 319c 4799 819e 790f 3bfc  f665 e7de 04b1 e585 1fb2 at depth  2.
Feb 8, 2003 8:24:38 AM (freenet.node.states.announcing.NewInitialRequest, 
QThread-1818): Scheduling post-announcement request on chain 275cd702bbfd270a, for key 
e34207fc8075e7d481e816b24cdf747e8e9db21d0f0203
Feb 8, 2003 8:24:38 AM (freenet.node.states.announcing.Announcing, QThread-1818): 
Announced node successfully to 95c1 dee1 b574 a378 6d94  a35c 02dc 7049 66f3 4c8b at 
depth  2.
Feb 8, 2003 8:39:10 AM (freenet.node.states.announcing.Announcing, QThread-1803): 
Found 1 announcement targets for this node.
Feb 8, 2003 8:39:30 AM (freenet.node.states.announcing.Announcing, QThread-1803): 
Announcement failed to 3d45 c09b 2617 813c 8d7b  994e 970f a2c5 517c 6f6d at depth  3.
Feb 8, 2003 8:54:10 AM (freenet.node.states.announcing.Announcing, QThread-1803): 
Found 1 announcement targets for this node.
Feb 8, 2003 8:54:11 AM (freenet.node.states.announcing.Announcing, QThread-1803): 
Announcement failed to 993f acca cc9a 9911 bb44  034b b74d a422 0072 7210 at depth  2.
Feb 8, 2003 9:09:10 AM (freenet.node.states.announcing.Announcing, QThread-1803): 
Found 1 announcement targets for this node.
Feb 8, 2003 9:09:13 AM (freenet.node.states.announcing.Announcing, QThread-1803): 
Announcement failed to 348a 08a4 51cd 6978 af9e  7b08 ece1 b28e e7ae 8dbf at depth  2.

It is one of my 554 nodes

/N

___
Support mailing list
[EMAIL PROTECTED]
http://hawk.freenetproject.org:8080/mailman/listinfo/support



[freenet-support] Connection attemtpts counter error

2003-02-07 Thread Niklas Bergh
Node version 660.. 6/4 successful (it was 3/1 right before)?

tcp/138.88.84.46:164411.0   none   4   6 (150%)   9 secs. ago
552   1   0   no


___
support mailing list
[EMAIL PROTECTED]
http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support



[freenet-support] Why would my node to this?

2003-02-07 Thread Niklas Bergh
Feb 7, 2003 12:07:42 PM (freenet.support.SimpleDataObjectStore,
QThread-486): Trying to write to c:\rtnodes_14166a
Feb 7, 2003 12:07:42 PM (freenet.support.SimpleDataObjectStore,
QThread-486): Trying to write to c:\rtprops_14166b

Version 660

/N


___
support mailing list
[EMAIL PROTECTED]
http://hawk.freenetproject.org/cgi-bin/mailman/listinfo/support



  1   2   >