Hi Anna,
Let's see one thing at a time.
wrote:
> ** If the three base pairs were UUU the value assigned to it (from the
> codon value table) would be 0.296
This can be done in Python, and one appropriate tool may be a dictionary
such as:
>>>
dna_table = {
"UUU" : 0.296,
"GG
Here's one approach to the problem (using bogus codon values).
-Original Message-
From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On
Behalf Of sjw28
Sent: Monday, March 06, 2006 8:37 AM
To: tutor@python.org
Subject: [Tutor] Analysing genetic code (DNA) using python
I have many note
> I have many notepad documents that all contain long chunks of genetic
> code. They look something like this:
>
> atggctaaactgaccaagcgcatgcgtgttatccgcgagaaagttgatgcaaccaaacag
[data example cut]
> Basically, I want to design a program using python that can open and
> read these documents.
Hello
On 3/6/06, sjw28 <[EMAIL PROTECTED]> wrote:
I have many notepad documents that all contain long chunks of geneticcode. They look something like this:atggctaaactgaccaagcgcatgcgtgttatccgcgagaaagttgatgcaaccaaacagtacgacatcaacgaagctatcgcactgctgaaagagctggcgactgctaaattcgtagaa
agcgtggacgtagctgttaacctcggcat
sjw28 wrote:
> I have many notepad documents that all contain long chunks of genetic
> code
> I've tried various ways of doing this but keep coming unstuck along the
> way. Has anyone got any suggestions for how they would tackle this
> problem?
> Thanks for any help recieved!
You really