On 3/6/02 8:35 AM, "Geoff Gibbs" <[EMAIL PROTECTED]> wrote:
> I have just upgraded to Spamassassin 2.11 from 2.01. > I am seeing a number of attachments being blocked as :- > SPAM: Content analysis details: (5.9 hits, 5 required) > SPAM: Hit! (2.7 points) BODY: A WHOLE LINE OF YELLING DETECTED > SPAM: Hit! (3.2 points) Message text disguised using base-64 encoding > The whole line of yelling is in fact part of the body of the > base-64 encoding. It seems somewhat harsh to block a message > purely on the basis that it contains an attachment. It's not purely that it contains an attachment -- it's that the attachment has a MIME type of text/* and that it's been base64-encoded anyway. The whole line of yelling test will match *after* the encoded thing's been decoded (I think), so it means that there's a whole line of yelling in the text/* attachment. > UK-Human Genome Mapping Project-Resource Centre, Watch out for lines like "GATTATATTCTTATTATCTTCCC" too! C _______________________________________________ Spamassassin-talk mailing list [EMAIL PROTECTED] https://lists.sourceforge.net/lists/listinfo/spamassassin-talk
