-----BEGIN PGP SIGNED MESSAGE----- Hash: SHA1
For sometime now (3 or 4 weeks I think) I have been noticing -ve Local Port numbers being reported in the Open Connection Manager screen (Connection Mode).
It does not seem to be associated with the remote node build since atm I have 3 connections to a node, 2 with -ve numbers and 1 with a +ve number.
I might add that I have 67 other connections to other nodes before you have a heart attack. All other Local Ports are in the range of 3000 to 5000. The negative Local Port number is -5 for both.
Just rechecked and all 3 connections to the node are now -5.
C:\USR\LOCAL\Freenet0.5 [\\VIXEN\Richard]$ ver
Microsoft Windows XP [Version 5.1.2600]
C:\USR\LOCAL\Freenet0.5 [\\VIXEN\Richard]$ java freenet.Version Freenet: Fred 0.6 (protocol 1.47) build 6339 (last good build: 6280)
C:\USR\LOCAL\Freenet0.5 [\\VIXEN\Richard]$ java -version java version "1.4.2_01" Java(TM) 2 Runtime Environment, Standard Edition (build 1.4.2_01-b06) Java HotSpot(TM) Client VM (build 1.4.2_01-b06, mixed mode)
Will install 6340 and check with that. Probably take some time to spot it though as it doesn't happen very often.
Richard - -- - ------------------------------------------------------------------------ CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCCCCCGCGCACTTATGCCTCAATAGATCTGCCACATCG CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGGGGGAAGTGTGGCATCCTTTTGCTTCAG dna.pl v0.2.4 (c) 20020613 (tm) rich at mibnet.plus.com -----BEGIN PGP SIGNATURE----- Version: GnuPG v1.2.3-nr1 (Windows XP) Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org
iD8DBQE/uzFyDehCPPrjI9gRAhVdAJ4vKRMTQxApFfHGEnB38web3aOAgQCfb5N+ 9PrmpUDUqEeAPgXapjUw6Pk= =Qpl2 -----END PGP SIGNATURE-----
-- ************************************************************************ This message has been swept clean of viruses by AVG Anti Virus email Scanner.
http://www.grisoft.com/html/us_index.cfm ************************************************************************ Checked by AVG anti-virus system (http://www.grisoft.com). Version: 6.0.541 / Virus Database: 335 - Release Date: 15/11/2003
_______________________________________________ Support mailing list [EMAIL PROTECTED] http://dodo.freenetproject.org/cgi-bin/mailman/listinfo/support
