On Thu, Jan 19, 2012 at 1:44 PM, Hs Hs <ilhs...@yahoo.com> wrote: > so I do not know what that pattern would be when I read in a string. I do > not know if regex could solve my kind of problem too. >
Ignore the python portion of the problem for now. Imagine someone handed you a piece of paper with the letters "AAATAGCAGAAATAAAAGAAAAGATTGGAACTAGGTCAG" written on it, and asked you to circle the section that you're trying to identify. How would you do it, without using a computer? How do you figure out where there was a mutation, and then how do you discover if that location is in a polymer region? If you can describe that process to us, maybe we can help you turn that into a python program. -- Jerry
_______________________________________________ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
