Hi, Hs !

I believe that in this list there are people that know a lot about either
regular expressions in Python, or about DNA strings.

They will be able to give you qualified help about what you are asking,
since you provide them enough data.

In any case, you can write to me privately  if you'd like to teach this
General Purpose programmer about DNA strings, i'd happy to learn about
them, as well to think about regular expressions in this context.

Maybe the two of us can think about an interesting solution for your
problem.

All the best,
Hilton

On Thu, Jan 19, 2012 at 4:44 PM, Hs Hs <[email protected]> wrote:

> Hi Hilton. Thanks for your suggestion.
>
>
> I saw re module. I should have explain a little bit in my message that
> patter of polymer is not constant. There could be variety of combinations
> given A, T G and C.
> it could be AAATAAA, ATATATAT, or GTAGTAGTA or GGGACCCGAAAT etc.
>
> so I do not know what that pattern would be when I read in a string. I do
> not know if regex could solve my kind of problem too.
>
> Thanks
> Hs.
>
>
>
>   ------------------------------
> *From:* Hilton Fernandes <[email protected]>
> *To:* "[email protected]" <[email protected]>
> *Cc:* Hs Hs <[email protected]>
> *Sent:* Thursday, January 19, 2012 1:39 PM
> *Subject:* Re: [Tutor] finding a polymer of letters in a string
>
> Hi !
>
> Have you considered regular expressions in Python ?
>
> Please take a look at "Regular Expression HOWTO", at
> http://docs.python.org/howto/regex.html
>
> All the best,
> Hilton
>
> On Thu, Jan 19, 2012 at 4:09 PM, Hs Hs <[email protected]> wrote:
>
> Hi:
> I am writing to see if I could any help.
> I am trying to find if a mutation in gene falls in a polymer region of
> DNA. To explain in simplistic terms,
>
> Given a piece of DNA string, with following characters, I know where
> mutation happens.  Happens at T (in quotes with spaces.) 3 As before T and
> 4 As after T are removed in a disease.
>
> Given following sequence, I should be able to find if this T is in a
> polymer region. such as 'AAA' T 'AAAA.
>
> AAATAGCAGAAA 'T' AAAAGAAAAGATTGGAACTAGGTCAG
>
>
>
> I am not sure if there are any methods in python to find these.  Do you
> think a script has to be written with more logic involving some known
> algorithms.
>
> Please advise.
>
> thanks
> Hs.
>
> _______________________________________________
> Tutor maillist  -  [email protected]
> To unsubscribe or change subscription options:
> http://mail.python.org/mailman/listinfo/tutor
>
>
>
>
> --
> (11)8131-5213
>
>
>
>
>


-- 
(11)8131-5213
_______________________________________________
Tutor maillist  -  [email protected]
To unsubscribe or change subscription options:
http://mail.python.org/mailman/listinfo/tutor

Reply via email to