tutor-requ...@python.org编写：
>Send Tutor mailing list submissions to > tutor@python.org > >To subscribe or unsubscribe via the World Wide Web, visit > http://mail.python.org/mailman/listinfo/tutor >or, via email, send a message with subject or body 'help' to > tutor-requ...@python.org > >You can reach the person managing the list at > tutor-ow...@python.org > >When replying, please edit your Subject line so it is more specific >than "Re: Contents of Tutor digest..." > > >Today's Topics: > > 1. Re: CSV -> sqlite tables with foreign keys (eryksun) > 2. Re: Why difference between printing string & typing its > object reference at the prompt? (Dwight Hutto) > 3. Re: managing memory large dictionaries in python (Dwight Hutto) > 4. Re: modulo (Dwight Hutto) > 5. program for a problem (Tharuni Dheeraj) > 6. Consecutive Sequence (syed zaidi) > > >---------------------------------------------------------------------- > >Message: 1 >Date: Wed, 17 Oct 2012 05:19:27 -0400 >From: eryksun <eryk...@gmail.com> >To: Monte Milanuk <memila...@gmail.com> >Cc: Tutor@python.org >Subject: Re: [Tutor] CSV -> sqlite tables with foreign keys >Message-ID: > <CACL+1avbryzMMWtiZHi9R4uBMgM3=nyzt65_nmdlnbndv5a...@mail.gmail.com> >Content-Type: text/plain; charset=UTF-8 > >On Tue, Oct 16, 2012 at 11:59 PM, Monte Milanuk <memila...@gmail.com> wrote: >> >> address = list(row) >> address.append(person) >> row = tuple(address) > >The rows from the csv.reader are already lists. Also, the parameter >list in the 2nd argument only needs to be a sequence (e.g. tuple, >list, string), or it can also be a dict if the statement uses named >placeholders. > >> from what I've found on the web, I get the distinct impression >> that converting from a tuple to a list and back is considered >> poor practice at best and generally to be avoided. > >To update a record in a tuple you can use slicing and concatenation >(+) as an alternative to creating a temporary list. A list is more >applicable to homogenous data (e.g. a list of tuples, each a data >record). If you want a container for a record that you can modify more >efficiently, use a dict or a custom object. For the latter, look into >ORMs such as Storm: > >https://storm.canonical.com/ > >> Any suggestions? > >I found a Stack Overflow answer that uses a table "view" combined with >an "instead of" trigger to update two tables with one insert. > >http://stackoverflow.com/a/11715983/205580 > >Here's my meager attempt at an adaptation (some names have been >changed to protect the innocent...): > > import csv > import sqlite3 > > con = sqlite3.connect(':memory:') > cur = con.cursor() > > cur.execute('''create table person ( > id integer primary key autoincrement, > firstname, midinit, lastname, birthdate) > ''') > > cur.execute('''create table address ( > id integer primary key autoincrement, > person_id integer references person not null, > street, city, state, zipcode) > ''') > > cur.execute('''create view person_view as > select > person.firstname, person.midinit, person.lastname, > person.birthdate, address.street, address.city, > address.state, address.zipcode > from > person inner join address on person.id = address.person_id > ''') > > cur.execute('''create trigger person_view_insert > instead of insert on person_view > begin > insert into > person (firstname, midinit, lastname, birthdate) > values (new.firstname, new.midinit, new.lastname, > new.birthdate); > insert into > address (person_id, street, city, state, zipcode) > values ((select last_insert_rowid()), > new.street, new.city, new.state, new.zipcode); > end > ''') > > import io > data = io.BytesIO(b'''\ > John,G.,Smith,1972-11-10,123 Any Place,Somewhere,Missouri,58932 > Jane,L.,Jones,1971-12-20,321 Some Place,Anywhere,Kansas,12345 > ''') > > reader = csv.reader(data) > for row in reader: > cur.execute('''insert into > person_view (firstname, midinit, lastname, birthdate, > street, city, state, zipcode) > values (?,?,?,?,?,?,?,?)''', row) > > # output > for row in cur.execute('select * from person'): > print row > for row in cur.execute('select * from address'): > print row > > >person table: > > (1, u'John', u'G.', u'Smith', u'1972-11-10') > (2, u'Jane', u'L.', u'Jones', u'1971-12-20') > >address table: > > (1, 1, u'123 Any Place', u'Somewhere', u'Missouri', u'58932') > (2, 2, u'321 Some Place', u'Anywhere', u'Kansas', u'12345') > > >------------------------------ > >Message: 2 >Date: Wed, 10 Oct 2012 21:58:39 -0400 >From: Dwight Hutto <dwightdhu...@gmail.com> >To: "Steven D'Aprano" <st...@pearwood.info> >Cc: tutor@python.org >Subject: Re: [Tutor] Why difference between printing string & typing > its object reference at the prompt? >Message-ID: > <CA+vVgJXY29009t04oUcqhT0=at6dw3y66pehf4zkjarfmi4...@mail.gmail.com> >Content-Type: text/plain; charset=ISO-8859-1 > >If your app has a standard usage of phrases, you can place a file in >that translates a tag into a particular language phrase. > > > >if submit_tag_selection == 'english': > submit = 'Submit' >if submit_tag_selection == 'english': > submit = 'Soumettre' > >Of course this could be done without the if, you would just translate >the normal selections within a file with the commonly used phrases in >the app, and substitute it within a parse for: > >x = open('translate_file_french', 'r') >for line in x: > if line.split('=')[0] == 'Submit': > print '%s' % (line.split('=')[1]) > >'Soumettre' > >*Untested, but should work > > >-- >Best Regards, >David Hutto >CEO: http://www.hitwebdevelopment.com > > >------------------------------ > >Message: 3 >Date: Tue, 16 Oct 2012 21:30:43 -0400 >From: Dwight Hutto <dwightdhu...@gmail.com> >To: Abhishek Pratap <abhishek....@gmail.com> >Cc: tutor@python.org >Subject: Re: [Tutor] managing memory large dictionaries in python >Message-ID: > <ca+vvgjx-9mqg9km_sfiwv_jme6mpnc1w50u3tvj78awckmr...@mail.gmail.com> >Content-Type: text/plain; charset=ISO-8859-1 > >On Tue, Oct 16, 2012 at 12:57 PM, Abhishek Pratap ><abhishek....@gmail.com> wrote: >> Hi Guys >> >> For my problem I need to store 400-800 million 20 characters keys in a >> dictionary and do counting. This data structure takes about 60-100 Gb >> of RAM. >> I am wondering if there are slick ways to map the dictionary to a file >> on disk and not store it in memory but still access it as dictionary >> object. Speed is not the main concern in this problem and persistence >> is not needed as the counting will only be done once on the data. We >> want the script to run on smaller memory machines if possible. >> >> I did think about databases for this but intuitively it looks like a >> overkill coz for each key you have to first check whether it is >> already present and increase the count by 1 and if not then insert >> the key into dbase. >> >> Just want to take your opinion on this. >> >> Thanks! >> -Abhi >> _______________________________________________ >> Tutor maillist - Tutor@python.org >> To unsubscribe or change subscription options: >> http://mail.python.org/mailman/listinfo/tutor > >My inexperienced advice would be to begin with the storage areas >available. I would begin by eliminating certain things such as: > >x = {'one_entry' : 1} > >into > >x = {'one_entry':1} > >To map, you would want maybe different db files that contain certain >info within a certain range. 0-1000 entries in the first file, etc. > >os.walk a directory, and find the mapped file in a particular range >file, then go straight to the entry needed. > >Make the dict one long line, and you could eliminate any /n newline chars. > > I could do better with more time, but that seems like a good solution >at this point. > >Best Regards, >David Hutto >CEO: http://www.hitwebdevelopment.com > > >------------------------------ > >Message: 4 >Date: Sun, 7 Oct 2012 20:16:03 -0400 >From: Dwight Hutto <dwightdhu...@gmail.com> >To: d...@davea.name >Cc: "tutor@python.org" <tutor@python.org>, Jan Karel Schreuder > <jan9...@me.com> >Subject: Re: [Tutor] modulo >Message-ID: > <CA+vVgJUbeTkUCi=fqqr4qi2yuclwo7l+wkbny6dkkgddnvp...@mail.gmail.com> >Content-Type: text/plain; charset=ISO-8859-1 > >______________________________________________ >>>> I'm not a professional programmer, so I might be way off base here. > >You mean you haven't dealt with this subject yet... > >But what I like about Pythons modulo solution is that I can use it to >right and left shift in lists or tuples, and I will link to the first >element when I right shift past the last element and link to the last >element when I left shift past the first element. In other words I can >consider the last as a chain where the last and the first element are >connected. This I find useful in surprisingly many situations. > >It's uised for, what it's used for, until you know the full lower >level implementation/parsing of objects like immutables(tuples), and >mutables(lists,dicts,strings,etc > >>> >>> >> Certainly, but you've never had to do that with lists or tuples having >> negative lengths. It's a negative modulus that I'm complaining about. > >Can you show some example code here? > >-- >Best Regards, >David Hutto >CEO: http://www.hitwebdevelopment.com > > >------------------------------ > >Message: 5 >Date: Mon, 8 Oct 2012 08:55:09 -0700 >From: Tharuni Dheeraj <tharunichowd...@gmail.com> >To: tutor@python.org >Subject: [Tutor] program for a problem >Message-ID: > <caecme6lmd5dwbqb4e_0jnypyoy5x0ueynq36wmgpuauhv8v...@mail.gmail.com> >Content-Type: text/plain; charset="iso-8859-1" > >please send me the program for the following que: > >Write a program that asks the user for a dollar amount.It then reports the >corresponding number of euros by using the current exchange rate. >-- >Regards, >Tharuni Dheeraj >-------------- next part -------------- >An HTML attachment was scrubbed... >URL: ><http://mail.python.org/pipermail/tutor/attachments/20121008/4ecc37c4/attachment-0001.html> > >------------------------------ > >Message: 6 >Date: Sat, 13 Oct 2012 12:02:20 +0100 >From: syed zaidi <syedzaid...@hotmail.co.uk> >To: <tutor@python.org> >Subject: [Tutor] Consecutive Sequence >Message-ID: <blu143-w8f81515088a8d2ab4889feb...@phx.gbl> >Content-Type: text/plain; charset="iso-8859-1" > > >Hi,I am trying to develop a python code that takes a character string as input >and finds for the occurrence of letters that are occurring thrice or more >consecutively.For E.g. >a = 'atttttaattaaacagagtgagcagaaaat'In the output I want a list of those >characters that are occuring thrice or more. >like in this case outout must b out_put = ['ttttt','aaa','aaaa'] >Can someone please suggest a code for this. > >-------------- next part -------------- >An HTML attachment was scrubbed... >URL: ><http://mail.python.org/pipermail/tutor/attachments/20121013/8aa14077/attachment.html> > >------------------------------ > >Subject: Digest Footer > >_______________________________________________ >Tutor maillist - Tutor@python.org >http://mail.python.org/mailman/listinfo/tutor > > >------------------------------ > >End of Tutor Digest, Vol 104, Issue 69 >************************************** _______________________________________________ Tutor maillist - Tutor@python.org To unsubscribe or change subscription options: http://mail.python.org/mailman/listinfo/tutor
