On 03/21/2014 10:39 PM, Cameron Simpson wrote:
On 21Mar2014 20:31, Mustafa Musameh <[email protected]> wrote:
Please help. I have been search the internet to understand how to write a
simple program/script with python, and I did not do anything.
I have a file that look like this
ID 1
agtcgtacgt…
ID 2
attttaaaaggggcccttcc
.
.
.
in other words, it contains several IDs each one has a sequence of 'acgt'
letters
I need to write a script in python where the output will be, for example, like
this
ID 1
a = 10%, c = 40%, g=40%, t = 10%
ID 2
a = 15%, c = 35%, g=35%, t = 15%
.
.
.
(i mean the first line is the ID and the second line is the frequency of each
letter )
How I can tell python to print the first line as it is and count characters
starting from the second line till the beginning of the next '>' and so on
You want a loop that reads lines in pairs. Example:
while True:
line1 = fp.readline()
print line1,
line2 = fp.readline()
... process the line and report ...
Then to process the line, iterate over the line. Because a line is
string, and a string is a sequence of characters, you can write:
for c in line2:
... collect statistics about c ...
... print report ...
I would collect the statistics using a dictionary to keep count of
the characters. See the dict.setdefault method; it should be helpful.
I think it would be easier to do that in 2 loops:
* first read the file line by line, building a list of pairs (id, base-sequence)
(and on the fly check the input is correct, if needed)
* then traverse the sequences of bases to get numbers & percentages, and write
out
d
_______________________________________________
Tutor maillist - [email protected]
To unsubscribe or change subscription options:
https://mail.python.org/mailman/listinfo/tutor