Hi all, I'm new to pig and need to format my file. I have fasta file with this fomat:
>1 abundance=7626 length=72 cross=0 CGACACGACTCTCGGCAACGGATA CGACACGACTCTCGGCAACGGATAC GACACGACTCTCGGCAACGGATA >3 abundance=4639 length=22 cross=1 CGACACGACTCTCGGCAACGGA CGACACGACTCTCGGCAACGGATA CGACACGACTCTCGGCAACGGATA >4 abundance=4302 length=24 cross=0 ACTTGTGCTGATTGGATGACTTGA >5 abundance=3785 length=23 cross=0 GACACGACTCTCGGCAACGGATA Each line which starts with '>' corresponds to one sequence, but the actual sequence might be stored in multiple lines like record 1. In each line, the first number is id. In the formatted file, I do not need id and cross. I need to format this file such that all records will be in just one line and without the keywords "abundance", "length", and "cross". So the ideal formatted file should be like that: 7626 72 CGACACGACTCTCGGCAACGGATACGACACGACTCTCGGCAACGGATACGACACGACTCTCGGCAACGGATA 4639 22 CGACACGACTCTCGGCAACGGACGACACGACTCTCGGCAACGGATACGACACGACTCTCGGCAACGGATA 4302 24 ACTTGTGCTGATTGGATGACTTGA 3785 23 GACACGACTCTCGGCAACGGATA Can I do this formatting in pig? Any help is highly appreciated. Zara This e-mail message may contain privileged and/or confidential information, and is intended to be received only by persons entitled to receive such information. If you have received this e-mail in error, please notify the sender immediately. Please delete it and all attachments from any servers, hard drives or any other media. Other use of this e-mail by you is strictly prohibited. All e-mails and attachments sent and received are subject to monitoring, reading and archival by Monsanto, including its subsidiaries. The recipient of this e-mail is solely responsible for checking for the presence of "Viruses" or other "Malware". Monsanto, along with its subsidiaries, accepts no liability for any damage caused by any such code transmitted by or accompanying this e-mail or any attachment. The information contained in this email may be subject to the export control laws and regulations of the United States, potentially including but not limited to the Export Administration Regulations (EAR) and sanctions regulations issued by the U.S. Department of Treasury, Office of Foreign Asset Controls (OFAC). As a recipient of this information you are obligated to comply with all applicable U.S. export laws and regulations.
