No,But Now I have tried it now its generating good spacing but the main
problem is how to align it at particular position "[(272, 277, 'AAAAA') "
of the string.I have tried with string method '{:>30}'.format('right
aligned') but it is not possible to put the string position .Is there any
syntax in html to align at particular position.On Fri, Oct 5, 2012 at 6:14 PM, Niphlod <[email protected]> wrote: > did you ever considered using <pre> to print this ? > Your visualization is probably falling apart because all the letters don't > "occupy" the same amount of space horizontally (and because multiple spaces > in html are stripped if not contained in a <pre>, and because a single > space varies with the font used ) > You can turn the font of those lines to something like Lucida Console > (those fonts you need are called "monospaced" because every letter takes > exactly the same amount of space horizontally) > > The same difference (hoping that you're reading from the google groups > interface than the emails) can be "simulated" here. 1st line without > spaces, 2nd line starts with 2 spaces, 3rd line starts with 4 spaces > > TAGCGCTTTAAACCCCCC > ACTAGTTAGERT > ACTATTAGTAAACCC > > as you can see, they are not aligned at all. However, if you wrap them in > a <pre>, then you can visualize it "correctly aligned", as the below example > > TAGCGCTTTAAACCCCCC > ACTAGTTAGERT > ACTATTAGTAAACCC > > > On Friday, October 5, 2012 5:19:48 PM UTC+2, praveen krishna wrote: >> >> Hi, >> I want to align two strings one has a long sequence and other is of >> type list which a has sub-strings all of same type and the starting and >> ending positions corresponding to first string .I have tried with html tags >> 'LI' and 'TR' but its not working can you suggest me better approach. >> example : >> string1 : **GCGCAACGCAATTAATGTGAGTTACCTCAC** >> TCATTAGGCACCCCAGGCTTTACACTTTAT**GCTTCCGGCTCCTATGTTGTGTGGAATTGT** >> GAGCGGATAACAATTTCACACAGGAAACAG**CTATGACCATGATTACGCCAAGCTCGGAAT** >> TAACCCTCACTAAAGGGAACAAAAGCTGGT**ACCGTCGAGGGATCCTCGTTACTCAATAAG** >> TATTAATTGTTCGATGCTGTTAGTAATGTT**CCTAACAGGGAAAGTTTCCGGCGAACAGGT** >> CTAAAAAAAGAAACAAAAAAAAAAAGAAGT**ACTCCGTATCACCGTGCGTTATTTTTAAAA** >> ATACGGAGTTAGTGTCTCAATCAAAAATGT**AAAGCCGCCTCCTCTCTAGTTTAGCTGTGG** >> AAGATTTCTTGTCATCGAATATACATCATA**TGTAACAATTCTTTTTCTCAATGTTTATGC** >> GTGACCCAAACATAATCTCTATCATTACCT**CAATTTTGTAAACAAAATGAACATACCTTA** >> AAGTTGAATTAGCCACCTCGTCACATCACA**TCGAATCGGAACTAGAAT >> sub bstring : >> [(272, 277, 'AAAAA'), (284, 289, 'AAAAA'), (289, 294, 'AAAAA'), (326, >> 331, 'AAAAA'), (352, 357, 'AAAAA') >> I want to align this sub string at the position starting from 252 to 260. >> what is will be the better approach. >> > -- > > > > --
