Hi Mike, if you send a plain sequence via stdin to an EMBOSS program, you must explicitly specify the sequence format as "plain".
echo "GATACTAATTGCCCGTGAGGCTTGA" | palindrome -filter -sformat plain David. emboss-boun...@lists.open-bio.org schrieb am 08/01/2012 17:57:35: > Greetings > > It seems like this should work: > > $ echo "GATACTAATTGCCCGTGAGGCTTGA" | palindrome -filter > Error: Unable to read sequence 'stdin' > Died: palindrome terminated: Bad value for '-sequence' with -auto > defined > > and yet as you can see, it does not. I haven't used it for awhile, but > I recall it used to work. > > I've searched the docs and tried all the permutations on the command I > can think of and I'm getting nowhere. > > Does anyone see a problem with the command or have a suggestion where > to search for a problem? > > Thanks > > Mike > > Michael Muratet, Ph.D. > Senior Scientist > HudsonAlpha Institute for Biotechnology > mmura...@hudsonalpha.org > (256) 327-0473 (p) > (256) 327-0966 (f) > > Room 4005 > 601 Genome Way > Huntsville, Alabama 35806 > > > > > > _______________________________________________ > EMBOSS mailing list > EMBOSS@lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/emboss _______________________________________________ EMBOSS mailing list EMBOSS@lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/emboss