Hi Mike,

if you send a plain sequence via stdin to an EMBOSS program, you must 
explicitly specify the sequence format as "plain".

echo "GATACTAATTGCCCGTGAGGCTTGA" | palindrome -filter -sformat plain

David.
emboss-boun...@lists.open-bio.org schrieb am 08/01/2012 17:57:35:

> Greetings
> 
> It seems like this should work:
> 
> $ echo "GATACTAATTGCCCGTGAGGCTTGA" | palindrome  -filter
> Error: Unable to read sequence 'stdin'
> Died: palindrome terminated: Bad value for '-sequence' with -auto 
> defined
> 
> and yet as you can see, it does not. I haven't used it for awhile, but 
> I recall it used to work.
> 
> I've searched the docs and tried all the permutations on the command I 
> can think of and I'm getting nowhere.
> 
> Does anyone see a problem with the command or have a suggestion where 
> to search for a problem?
> 
> Thanks
> 
> Mike
> 
> Michael Muratet, Ph.D.
> Senior Scientist
> HudsonAlpha Institute for Biotechnology
> mmura...@hudsonalpha.org
> (256) 327-0473 (p)
> (256) 327-0966 (f)
> 
> Room 4005
> 601 Genome Way
> Huntsville, Alabama 35806
> 
> 
> 
> 
> 
> _______________________________________________
> EMBOSS mailing list
> EMBOSS@lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss
_______________________________________________
EMBOSS mailing list
EMBOSS@lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/emboss

Reply via email to