On 01/26/2010 02:08 PM, bia.estat wrote:
Hi, I need to read a string vector in R which is like this
"atgctaaaactaatcgtcccaacaattatattactaccac", but R seems to understand it as
a unique vector input when I read in like x<-
"atgctaaaactaatcgtcccaacaattatattactaccac". How do I unconcatenate it, so I
can use each of the letters on my reading?
Thanks,
Beatriz
See ?strsplit
> strsplit( x, "")[[1]]
Romain
--
Romain Francois
Professional R Enthusiast
+33(0) 6 28 91 30 30
http://romainfrancois.blog.free.fr
|- http://tr.im/KfKn : Rcpp 0.7.2
|- http://tr.im/JOlc : External pointers with Rcpp
`- http://tr.im/JFqa : R Journal, Volume 1/2, December 2009
______________________________________________
R-help@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/r-help
PLEASE do read the posting guide http://www.R-project.org/posting-guide.html
and provide commented, minimal, self-contained, reproducible code.