Hi Hirra, The assignment is not random, it follows the order of the sequences in the data:
- Seqs. A and B are compared and found to be identical so they are both assigned to haplotype I. - Seq. C is compared to haplotype I (effectively seq. A) and found to be different so it is assigned to haplotype II. - Seq. D is compared to haplotype I and found to be similar and so assigned to haplotype I. If you reorder your data and put Seq. C first, you'd obtain that C and D are assigned to the same haplotype. The same issue occurs with ambiguous bases. These situations certainly deserve to have an option to haplotype() to handle them properly. Best, Emmanuel ----- Le 25 Fév 20, à 19:31, Hirra Farooq hirra.far...@postgrad.manchester.ac.uk a écrit : > Hello, > > I am using the pegas R package to assign sequences into haplotypes. > > I recently tried out a test examples with 4 sequences. 2 of the sequences (A > and > B) are identical, 1 sequence (Seq C) differs from these at only one position > (pos 648). > The 4th sequence (Seq D) is identical to all but shorter so has no residues at > the determinant position 648. (See image below) > > So correctly pegas assigns A and B to haplotype I and C to haplotype II. > However > it also assigns D to I, despite there being no information at which residue is > at the determinant position. > > I just wanted to know in such cases as D when there is missing information, > does > pegas just randomly assign to a haplotype? > > > > > aln (633..663) names > [A] CCCGATTTTATATCAACATTTATTT------ > [D] CCCGATTTT---------------------- > [B] CCCGATTTTATATCAACATTTATTT------ > [C] CCCGATTTTATATCACCATTTATTTTGATTT > > > Thanks and best wishes, > Hirra > University of Manchester Student. > > [[alternative HTML version deleted]] > > _______________________________________________ > R-sig-phylo mailing list - R-sig-phylo@r-project.org > https://stat.ethz.ch/mailman/listinfo/r-sig-phylo > Searchable archive at http://www.mail-archive.com/r-sig-phylo@r-project.org/ _______________________________________________ R-sig-phylo mailing list - R-sig-phylo@r-project.org https://stat.ethz.ch/mailman/listinfo/r-sig-phylo Searchable archive at http://www.mail-archive.com/r-sig-phylo@r-project.org/
