Hi Hirra, I've tried with the data you pisted below using pegas 0.12 and I was not able to repeat your results: I found that seqs. 1 and 3 are grouped in the same haplotype (not 1 and 2). Anyway, this is the same issue that you pointed out a few days ago: seq. 3 could be grouped with seq. 1 or seq. 2. I have now implemented the changes I described in my previous message, and have just pushed pegas 0.12-999 on GitHub. This also include changes to make pegas work with R 4.0.0 (see the results of R CMD check on CRAN for details). This new version will be submitted to CRAN in a few days as pegas 0.13. In the meantime, don't hesitate to try this new version!
Best, Emmanuel ----- Le 3 Mar 20, à 21:00, Hirra Farooq hirra.far...@postgrad.manchester.ac.uk a écrit : > Hello, > > I have a question about the pegas haplotype algorithm and would be grateful if > someone could explain. > > I used pegas haplotype() on a set of sequences. I then manually aligned and > looked at the sequences within each haplotype. For one haplotype I noticed > something odd (see image below) > > Although there was a single bp difference at the highlighted position ,these > sequences had all been assigned as one haplotype. I understand that for the > 3rd > sequence because there are gaps at this highlighted position this can lead it > to be pooled with others, but I do not understand how sequence 1 and 2 can be > in the same haplotype? > > I would be grateful for any guidance, > > > > > > > GBSP11539-19|Ophlitaspon[1] > AATACTGCATTTTTTGACCCTGCAGGGGGAGGAGACCCCATTTTATATCAACATTTATTT 660 > GBSP11518-19|Ophlitaspon[2] > AATACTGCATTTTTTGACCCTGCGGGGGGAGGAGACCCCATTTTA--------------- 645 > GBSP11504-19|Ophlitaspon[3] > AATACTGCAT-------------------------------------------------- 580 > GBSP11512-19|Ophlitaspon[4] > AATACTGCATTTTTTGACCCTGCAGGGGGAGGAGACCCATTTATATCACTTTATTTGTT- 659 > ********** > > Best wishes > Hirra > University of Manchester Student. > > [[alternative HTML version deleted]] > > _______________________________________________ > R-sig-phylo mailing list - R-sig-phylo@r-project.org > https://stat.ethz.ch/mailman/listinfo/r-sig-phylo > Searchable archive at http://www.mail-archive.com/r-sig-phylo@r-project.org/ _______________________________________________ R-sig-phylo mailing list - R-sig-phylo@r-project.org https://stat.ethz.ch/mailman/listinfo/r-sig-phylo Searchable archive at http://www.mail-archive.com/r-sig-phylo@r-project.org/
