Re: [ccp4bb] Trimming of carbohydrate chains
Dear Herman, Assuming that the protein is eukaryotic, and glycans N-linked, various ways of dealing with the issue are described in PMID: 17355862. Best wishes, radu -- A. Radu Aricescu, PhD MRC Senior Research Fellow Associate Professor University of Oxford Wellcome Trust Centre for Human Genetics Division of Structural Biology Roosevelt Drive, Oxford OX3 7BN United Kingdom Phone: +44-1865-287564 Fax: +44-1865-287547 https://www.strubi.ox.ac.uk/research/a-radu-aricescu Original message Date: Wed, 15 Oct 2014 13:03:13 + From: CCP4 bulletin board CCP4BB@JISCMAIL.AC.UK (on behalf of herman.schreu...@sanofi.com) Subject: [ccp4bb] Trimming of carbohydrate chains To: CCP4BB@JISCMAIL.AC.UK Dear Bulletin Board, I am struggling with a protein domain of 15 kDa, with about 22 kDa carbohydrate attached. So far, the domain did not crystallize and I suspect the carbohydrate may hinder crystallization. Completely removing the carbohydrate results in low expression yields and poorly soluble protein, so I would like to try to remove some, but not all carbohydrate. Does anyone has a good protocol to trim, but not completely remove the carbohydrate? Thank you, Herman Schreuder
Re: [ccp4bb] Sighting of Protein Crystals in Vivo?!
Hi Jacob, They are not too small to mount I think, at least 20 microns long (compared to the size of surrounding cells). But what do you mean by littered? There seems to be just one cell with crystals out of say 10 expressing eGFP. And why are there only 10 or so expressing GFP out of ~200 or more cells in the field? This does not look like transient expression using a normal plasmid... Very intriguing nevertheless! radu -- A. Radu Aricescu, PhD University Research Lecturer University of Oxford Wellcome Trust Centre for Human Genetics Division of Structural Biology Roosevelt Drive, Oxford OX3 7BN United Kingdom Phone: +44-1865-287564 Fax: +44-1865-287547 Original message Date: Fri, 15 Feb 2013 14:44:32 -0500 From: CCP4 bulletin board CCP4BB@JISCMAIL.AC.UK (on behalf of Jacob Keller j-kell...@fsm.northwestern.edu) Subject: [ccp4bb] Sighting of Protein Crystals in Vivo?! To: CCP4BB@JISCMAIL.AC.UK Dear Crystallographers, I was looking at some live, control HEK cells expressing just eGFP, and to my great surprise, saw littered across the dish what appeared to be small fluorescent needles (see attached--sorry about the size, but it's only ~1MB total.) Can these possibly be fortuitous protein crystals? They were too small to mount I think, and for what it's worth, parallel-transfected HeLa cells did not have these things. But, some needles could be seen in the DIC images as well, and the needles were only fluorescent with GFP filter sets, and not CFP, YFP, or texas red filters. I thought of whale myoglobin crystallizing on the decks of ships, but never thought I would see this Jacob -- *** Jacob Pearson Keller, PhD Postdoctoral Associate HHMI Janelia Farms Research Campus email: j-kell...@northwestern.edu *** GFP_crystals_DIC.png (938k bytes) GFP_crystals_Fluorescence.png (586k bytes)
[ccp4bb] Postdoctoral position, C2D2, University of York
An exciting junior postdoc opportunity, ideal for the structure-educated biochemist looking to brush-up their maths skills (or finally put them to some good use :-)): Mathematical modelling of bi-directional synaptic signalling Details at: http://www.nature.com/naturejobs/science/jobs/303788-Discipline-hopping-internships or http://www.york.ac.uk/c2d2/internships/ For informal enquiries contact: radu.caline...@york.ac.uk -- A. Radu Aricescu, PhD University Research Lecturer University of Oxford Wellcome Trust Centre for Human Genetics Division of Structural Biology Roosevelt Drive, Oxford OX3 7BN United Kingdom Phone: +44-1865-287564 Fax: +44-1865-287547 Original message Date: Tue, 29 Jan 2013 10:46:09 + From: CCP4 bulletin board CCP4BB@JISCMAIL.AC.UK (on behalf of Andrew Carter cart...@mrc-lmb.cam.ac.uk) Subject: [ccp4bb] Postdoctoral position MRC Laboratory of Molecular Biology, Cambridge, UK To: CCP4BB@JISCMAIL.AC.UK An opportunity is available for a postdoctoral researcher to work on structural or single molecule studies of the microtubule motor dynein. The project aims to characterise functionally relevant parts of the cytoplasmic dynein complex in order to understand its motility, regulation and interaction with cargos. There will be opportunities to combine structural biology with assays that take advantage of single molecule fluorescence microscopy. I am looking for an enthusiastic individual who is likely to thrive in a laboratory with a friendly and supportive atmosphere. You should have a PhD in a relevant biological subject and a desire to understand dynein's structure and function. Experience is required in one or more of the following areas: molecular biology, protein expression, protein crystallisation or single molecule biophysics. Successful applicants will be awarded a three-year Career Development Fellowship. The fellowship is a training and development position for a post-doctoral scientist who has recently completed their doctoral studies, is moving into a new research discipline or has limited experience of key transferable skills. Applications are handled by the RCUK Shared Services Centre; to apply please visit our job board at www.topcareer.jobs. If you are unable to apply online please contact us on 01793 867003 quoting reference IRC80031 For more information about the position please contact me (Andrew Carter) (cart...@mrc-lmb.cam.ac.uk) or visit my lab website at http://www2.mrc-lmb.cam.ac.uk/groups/cartera Best wishes Andrew
Re: [ccp4bb] install crystallography software on mac
Best place to start: http://scottlab.ucsc.edu/~wgscott/xtal/wiki/index.php/Crystallography_on_OS_X -- A. Radu Aricescu, PhD University Research Lecturer University of Oxford Wellcome Trust Centre for Human Genetics Division of Structural Biology Roosevelt Drive, Oxford OX3 7BN United Kingdom Phone: +44-1865-287564 Fax: +44-1865-287547 Original message Date: Mon, 28 Jan 2013 17:09:30 +0800 From: CCP4 bulletin board CCP4BB@JISCMAIL.AC.UK (on behalf of LISA science...@gmail.com) Subject: [ccp4bb] install crystallography software on mac To: CCP4BB@JISCMAIL.AC.UK Hi all, I am trying to install ccp4, phenix, coot and other crystallography software on my mac. I am not familiar with mac, neither Linux system. Please give me some protocols to install these software and how to update them. I appreciate it. Lisa
Re: [ccp4bb] The effect of His-tag location on crystallization
Or indeed support surreal structures :-))
(PMID: 11853672 vs PMID: 14749821 and so on)
--
A. Radu Aricescu, PhD
University Research Lecturer
MRC Career Development Award Fellow
University of Oxford
Wellcome Trust Centre for Human Genetics
Division of Structural Biology
Roosevelt Drive, Oxford OX3 7BN
United Kingdom
Phone: +44-1865-287564
Fax: +44-1865-287547
Original message
Date: Wed, 27 Jun 2012 12:21:22 -0400
From: CCP4 bulletin board CCP4BB@JISCMAIL.AC.UK (on behalf of Bosch,
Juergen jubo...@jhsph.edu)
Subject: Re: [ccp4bb] The effect of His-tag location on crystallization
To: CCP4BB@JISCMAIL.AC.UK
Here's another example:
http://www.pdb.org/pdb/explore/explore.do?structureId=2F62
dimer with His-tag-ears without His6-tag this
would not have been possible.
Jürgen
On Jun 27, 2012, at 12:04 PM, Brad Bennett wrote:
I think it was an N-terminal RGS-type His tag in
3O8Y (human lipoxygenase) that mediated crystal
contacts with a symmetry related molecule. As I
recall, this tag composed a B-strand that formed a
nice interface with a native B-strand of the
symmetry related molecule. Pretty cool...
-Brad
On Wed, Jun 27, 2012 at 11:00 AM, Phoebe Rice
pr...@uchicago.edu wrote:
With Flp recombinase - DNA complexes, a
C-terminal His tag triggered a different (but
sadly not better) crystal form, and the His side
chains packed against the bases at the end of a
neighboring DNA duplex.
=
Phoebe A. Rice
Dept. of Biochemistry Molecular Biology
The University of Chicago
phone 773 834 1723
http://bmb.bsd.uchicago.edu/Faculty_and_Research/01_Faculty/01_Faculty_Alphabetically.php?faculty_id=123
http://www.rsc.org/shop/books/2008/9780854042722.asp
Original message
Date: Wed, 27 Jun 2012 10:14:58 -0400
From: CCP4 bulletin board
CCP4BB@JISCMAIL.AC.UK (on behalf of R. M.
Garavito rmgarav...@gmail.com)
Subject: Re: [ccp4bb] The effect of His-tag
location on crystallization
To: CCP4BB@JISCMAIL.AC.UK
Most of the comments you will get will be
anecdotal
in that people will report the successful
results
and do not take the time or effort to
characterize
the less successful results. This often
occurs
because the tagged portion of the protein is
most
often disordered, even in the best crystals.
Thus,
other than saying tagging on this end
works, but
tagging on that end doesn't, there is
little more
you can say. Each case will be different,
and it is
almost impossible to arrive at any
generalized
conclusion.
We prefer C-terminal tagged proteins for a
number of
reasons, but if an N-terminally tagged
protein
crystallizes well, so be it. Of the dozens
of N-
and C-tagged protein structures we have
solved in my
lab and with collaborators, I have only seen
one
case of an ordered His-tag: the His
residues had
coordinated Cd ions, which proved essential
for
getting good crystals. However, beyond that
there
was not much more to say.
For your protein and the resulting crystals,
an
N-terminally tagged protein crystallized
well.
Whether you can draw any more conclusions
from
these results depends on characterizing
crystals of
both N- and C-tagged proteins. Just
assuming that
the C-tagged protein is trying to
crystallize in the
same or related crystal form as the N-tagged
protein
is an unwarranted assumption without
experimental
evidence to back it up. That is why most
groups
just run with the winner.
Cheers,
Michael
R. Michael Garavito, Ph.D.
Professor of Biochemistry Molecular
Biology
603 Wilson Rd., Rm. 513
Michigan State University
East Lansing, MI 48824-1319
Office: (517) 355-9724 Lab: (517)
353-9125
FAX: (517) 353-9334
Email: rmgarav...@gmail.com
On Jun 26, 2012, at 9:06 PM, weliu wrote:
Dear all,
We crystallized a protein and found that
crystal
quality greatly depended on the location
of
His-tag. When a His-tag was added at the
C-terminus, only crystalline
Re: [ccp4bb] mammalian expression vector
Hi Jerry, You may find that pcDNA3.1 won't give you the protein yields needed for crystallization. Have a look at PMID: 17001101 for an alternative. Your Kozak sequence looks good, radu -- A. Radu Aricescu, PhD University Research Lecturer MRC Career Development Award Fellow University of Oxford Wellcome Trust Centre for Human Genetics Division of Structural Biology Roosevelt Drive, Oxford OX3 7BN United Kingdom Phone: +44-1865-287564 Fax: +44-1865-287547 Original message Date: Tue, 13 Mar 2012 19:36:30 -0700 From: CCP4 bulletin board CCP4BB@JISCMAIL.AC.UK (on behalf of Jerry McCully for-crystallizai...@hotmail.com) Subject: [ccp4bb] mammalian expression vector To: CCP4BB@JISCMAIL.AC.UK Dear ALL; As an alternative strategy to avoid endotoxin, I plan to express the protein in mammalian cells. As suggested by others, the typical vector is pcDNA3.1(+). Does anyone have comments on this vector or recommend some other powerful vectors? I am new to mammalian expression. I designed a Kozak sequence followed by a BSA signal peptide in order to clone the target into pcDNA3.1(+). Is it right? Tentative Kozak sequence: GAGCTCGGATCCGCCACCATGAAGTGGGTAACCTTTCTCCTCCTCCTCTTCATCTCCGGTTCTGCCCT Thanks a lot, Jerry
Re: [ccp4bb] FW: [ccp4bb] highly glycosylated protein
Dear Wei, If I understood correctly your description, the protein aggregates when produced whith complex N-linked glycosylation, and behaves better when the glycosylation is immature (i.e. following kifunensine treatment I suppose ?). May I suggest that this is a rather atypical situation? It is also not clear to me whether the behaviour you describe follows deglycosylation attempts or not? Unless your protein is meant to be an ER lumen resident, mature glycosylation should help stabilize it. I would suggest against spending time and effort in making a stable CHO LecR cell line, at this stage at least. It will give you no better protein that kifunensine-trated HEK293 cells. Transient expression in the HEK 293S GnTI-, as suggested by others, will be a lot faster (a week will probably give you enough material to understand your protein, which is what you still need to do now, play with deglycosylation conditions etc) and produce a more homogeneous sample than CHOs (which are leaky, see Chang et al 2007, PMID: 17355862, for details). Best wishes, radu -- A. Radu Aricescu, PhD University Research Lecturer MRC Career Development Award Fellow University of Oxford Wellcome Trust Centre for Human Genetics Division of Structural Biology Roosevelt Drive, Oxford OX3 7BN United Kingdom Phone: +44-1865-287564 Fax: +44-1865-287547 Original message Date: Tue, 17 May 2011 18:35:50 +0200 From: CCP4 bulletin board CCP4BB@JISCMAIL.AC.UK (on behalf of Wei Li wei...@helmholtz-hzi.de) Subject: [ccp4bb] FW: [ccp4bb] highly glycosylated protein To: CCP4BB@JISCMAIL.AC.UK Dear Pascal and Matthias, I am sorry for the delay of reply, thanks very much for your suggestions on the glycosylation protein. Now I am trying to do a stable cell line with CHO lec 3.8.2.1 cells, this cell line could express protein with shorter glycans. I hope several weeks later I could get some better result. I will also try to use the Glycosylation deficient cell lines. I am still working on it, thanks again for your valuable advice. Best regards, Wei From: Matthias Zebisch [mailto:matthias.zebi...@bbz.uni-leipzig.de] Sent: 2011年5月13日 18:15 To: Wei Li Subject: Re: [ccp4bb] highly glycosylated protein Try to get hold of GntI deficient HEK293S cells (not commercially available). Expression takes two weeks but you can achieve comparable yields to HEK293T. These cells yield very homogenous bands on SDS PAGE. However, check also for O glycosylation prediction. As you appear to be from Braunschweig, ask Prof. Sträter in Leipzig. He can send you these cells. Good luck, Matthias From: Pascal Egea [mailto:pas...@msg.ucsf.edu] Sent: 2011年5月13日 18:01 To: Wei Li Cc: CCP4BB@jiscmail.ac.uk Subject: Re: [ccp4bb] highly glycosylated protein Hi Wei, Glycosylation usually stabilize proteins although it is a source of structural heterogeneity for us crystallographers.Since you are expressing in HEK293 cells, there is a strain of cells that is deficient for glycosylation (it was designed by Gobind Khorana at the MIT I believe). You may want to try this. This is particularly useful when you express membrane proteins, it avoids hyperglycosylation. You may want to try a lightly glycosylated version of your protein and see if it behaves correctly, The other extreme solution is to identify all occupied sequons in your protein and eventually inactivate them by mutagenesis to have a completely deglycosylated protein. This solution is probably not the best since glycosylation usually stabilize proteins and may be essential to their biological function and activity. So it is to be considered with a lot of caution. Hope this helps. -- Pascal F. Egea, PhD Assistant Professor UCLA, David Geffen School of Medicine Department of Biological Chemistry 356 Boyer Hall office (310)-983-3515 lab (310)-983-3516 email pe...@mednet.ucla.edu Helmholtz-Zentrum für Infektionsforschung GmbH | Inhoffenstraße 7 | 38124 Braunschweig | www.helmholtz-hzi.de Vorsitzende des Aufsichtsrates: MinDir’in Bärbel Brumme-Bothe, Bundesministerium für Bildung und Forschung Stellvertreter: MinDirig Heiko Gevers, Niedersächsisches Ministerium für Wissenschaft und Kultur Geschäftsführung: Prof. Dr. Dirk Heinz; Ulf Richter, MBA Gesellschaft mit beschränkter Haftung (GmbH) Sitz der Gesellschaft: Braunschweig Handelsregister: Amtsgericht Braunschweig, HRB 477
Re: [ccp4bb] Deglycosylation enzymes
Hi Aaron, There is a very simple way around (or through :-)) such walls of silence. Both enzymes are rather small (see UniProt Q9XBM8 and P36911) and in a week or so you can have synthetic cDNAs built as you wish. The cost should be equivalent to the purchase of a few enzyme aliquots, so not a bad deal in long term. Best wishes, radu -- A. Radu Aricescu, PhD University of Oxford Wellcome Trust Centre for Human Genetics Division of Structural Biology Roosevelt Drive, Oxford OX3 7BN United Kingdom Phone: +44-1865-287564 Fax: +44-1865-287547 Original message Date: Fri, 18 Jun 2010 17:10:55 +1000 From: CCP4 bulletin board CCP4BB@JISCMAIL.AC.UK (on behalf of Aaron Oakley aar...@uow.edu.au) Subject: [ccp4bb] Deglycosylation enzymes To: CCP4BB@JISCMAIL.AC.UK Hi all, I am looking to obtain plasmids encoding the deglycosylating enzymes peptide-N-glycosidase F and endoglycosidase F1 for expression as fusion proteins with GST. They were described in the following paper: Deglycosylation of proteins for crystallization using recombinant fusion protein glycosidases. F. Grueninger-Leitch, A. D'Arcy, B. D'Arcy, and C. Chène Department of Gene Technologies, Pharma Preclinical Research, F. Hoffmann-La Roche AG, Basel, Switzerland. Protein Sci. 1996 December; 5(12): 2617–2622. Has anyone here had any luck obtaining them? I understand that a materials transfer agreement is needed. I have tried contacting the authors and Hoffmann-La Roche via four difference channels and have met with a wall of silence! Any help here would be appreciated! With thanks, a++
Re: [ccp4bb] update on SeMet production
Dear Tim, I'd dare to say that SeMet labelling in mammalian cells is in fact routine (at least in our lab, and others' around the world) for quite a while :-) Since you mentioned CHO LecR cells, one can find references as early as 1994 from Wayne Hendrickson's lab (PMID: 7922031) and many others followed. More recently, people have moved to transient expression and probably the easiest labelling method for HEK293 cells can be found in PMID: 17001101. Best wishes, radu -- A. Radu Aricescu, PhD University of Oxford Wellcome Trust Centre for Human Genetics Division of Structural Biology Roosevelt Drive, Oxford OX3 7BN United Kingdom Phone: +44-1865-287564 Fax: +44-1865-287547 Original message Date: Tue, 23 Mar 2010 13:39:09 +0100 From: CCP4 bulletin board CCP4BB@JISCMAIL.AC.UK (on behalf of Jovine Luca luca.jov...@ki.se) Subject: Re: [ccp4bb] update on SeMet production To: CCP4BB@JISCMAIL.AC.UK Dear Tim, Although it is not routine, it can be done in mammalian cells too! For example, have a look at this: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2242577/pdf/2008.p df HTH, Luca - --- Luca Jovine, Ph.D. Karolinska Institutet Department of Biosciences and Nutrition Center for Biosciences Hälsovägen 7, SE-141 57 Huddinge, Sweden Voice: +46.(0)8.6083-301 FAX: +46.(0)8.6081-501 E-mail: luca.jov...@ki.se W3: http://jovinelab.org - --- On Mar 23, 2010, at 1:25 PM, Tim Gruene wrote: Dear all, since I am currenty preparing a lecture on crystallography I am wondering about the status quo of the production of SeMet proteins. In 2003, if I remember correctly, it was possible to express SeMet proteins in E.coli and insect cells. Has this been extended to other systems, and if so, which ones? Thanks a lot, Tim -- -- Tim Gruene Institut fuer anorganische Chemie Tammannstr. 4 D-37077 Goettingen GPG Key ID = A46BEE1A
[ccp4bb] OXION Postdoc fellowships and DPhil/PhD studentships
OXION is a research initiative grouping 25 UK laboratories based in Oxford, Cambridge and London and aimed at structural and functional characterisation of ion channels (http://oxion.dpag.ox.ac.uk/). Two training fellowships (at the junior or senior postdoctoral level, application deadline: Nov 14th, 2008) and up to four graduate studentships (application deadline: Jan 9th, 2009), generously funded by the Wellcome Trust, have been recently advertised. More details can be found at: http://oxion.dpag.ox.ac.uk/fellowshipsandstudentships Candidates with experience in membrane protein expression, purification and crystallization are warmly invited to apply :-) Best wishes, radu -- A. Radu Aricescu, PhD University of Oxford Wellcome Trust Centre for Human Genetics Division of Structural Biology Roosevelt Drive, Oxford OX3 7BN United Kingdom Phone: +44-1865-287551 Fax: +44-1865-287564
Re: [ccp4bb] Deglycosylation
Dear Eugenio, I believe the paper by Chang VT et al 2007 (PMID: 17355862) might offer the answers you're after (assuming N-glycosylation is your main concern). For O-linked sugars, the situation is much more complex, reflecting their diversity: mucin-type can usually be dealt with by construct design (eliminate Ser/Thr/Pro-rich domains), for other types have a look at http://www.prozyme.com/pdf/gk80110.pdf for example. Best wishes, radu -- A. Radu Aricescu, PhD University of Oxford Wellcome Trust Centre for Human Genetics Division of Structural Biology Roosevelt Drive, Oxford OX3 7BN United Kingdom Phone: +44-1865-287551 Fax: +44-1865-287547 Original message Date: Thu, 25 Sep 2008 11:30:24 -0700 From: Eugenio De la Mora [EMAIL PROTECTED] Subject: [ccp4bb] Deglycosylation To: CCP4BB@JISCMAIL.AC.UK Dear all, We have some troubles with the cristallization of glycosylated proteins and want to try to deglycosate them. We have never done this so we want to know what enzymes are the best (efficiency; less protein loss, ... ). And if it gaves better results in crystallization screens. Thank you Eugenio De la Mora Instituto de Biotecnologia Universidad NAcional Autonoma de Mexico
[ccp4bb] Fwd: [ccp4bb] HEK293S
Dear Vaheh, I'm not aware of a commercial or cell bank source, but you can get these cells from HG Khorana's lab at MIT. Best wishes, radu -- A. Radu Aricescu, PhD University of Oxford Wellcome Trust Centre for Human Genetics Division of Structural Biology Roosevelt Drive, Oxford OX3 7BN United Kingdom Phone: +44-1865-287551 Fax: +44-1865-287547 ---BeginMessage--- Please, forgive my partially off-topic question. I'm looking for commercial or cell bank source for GnTI-deficient HEK293S cells and will appreciate any suggestions on how to get them. P.S. It's partially off-topic since the cells will be used to produce protein for crystallography. Thanks. ___ Vaheh To the extent this electronic communication or any of its attachments contain information that is not in the public domain, such information is considered by MedImmune to be confidential and proprietary. This communication is expected to be read and/or used only by the individual(s) for whom it is intended. If you have received this electronic communication in error, please reply to the sender advising of the error in transmission and delete the original message and any accompanying documents from your system immediately, without copying, reviewing or otherwise using them for any purpose. Thank you for your cooperation. ---End Message---
Re: [ccp4bb] insect expression system
Dear Yong-fu, Why would you worry about insect expression systems if you already can secrete your constructs in mammalian cells? For such proteins, transient expression in HEK cells for example gives higher yields than baculo, is faster, cheaper, you can nicely control glycosylation, easily do Se-Met labelling and so on. Here are some references (PMID): 17355862, 17001101, 16823037, 11788735, 16082028. Radu -- A. Radu Aricescu, PhD University of Oxford Wellcome Trust Centre for Human Genetics Division of Structural Biology Roosevelt Drive, Oxford OX3 7BN United Kingdom Phone: +44-1865-287551 Fax: +44-1865-287547 Original message Date: Wed, 28 May 2008 10:40:16 -0400 From: Yong-Fu Li [EMAIL PROTECTED] Subject: [ccp4bb] insect expression system To: CCP4BB@JISCMAIL.AC.UK Hi, I searched my mail box for possible answers you have given but couldn't find any. The question is about selecting insect expression systems for mammalian or viral glycosylated proteins. There is confirmed expression of the target proteins in mammalian cells. They are secreted into the media. 1) Baculovirus system 2) Drosophila system Which system would you recommend for high expression and convenience? Has anyone ever compared those systems side by side? Any suggestions or references are greatly appreciated. Yongfu Li
