[Haskell-cafe] Fwd: shootout
hello cafe-istas -- for those of you who are into these things, a lot of the shootout programs are suffering from make errors and thus do not have benchmarks. http://shootout.alioth.debian.org/u64q/haskell.php best, ben Begin forwarded message: From: Don Stewart don...@gmail.com Date: July 30, 2011 9:52:12 AM PDT To: Ben midfi...@gmail.com Cc: Don Bruce Stewart d...@cse.unsw.edu.au Subject: Re: shootout Best to bring this up on haskell-cafe@ On Sun, Jul 31, 2011 at 12:34 AM, Ben midfi...@gmail.com wrote: FYI, a lot of the haskell programs on the shootout suffer from make errors and thus do not have benchmarks. best, ben ___ Haskell-Cafe mailing list Haskell-Cafe@haskell.org http://www.haskell.org/mailman/listinfo/haskell-cafe
[Haskell-cafe] A language that runs on the JVM or .NET has the advantage of Oracle Microsoft making those layers more parallelizable.
Are there plans a foot (or under fingers) to make a version of Haskell that runs on the JVM? -- -- Regards, KC ___ Haskell-Cafe mailing list Haskell-Cafe@haskell.org http://www.haskell.org/mailman/listinfo/haskell-cafe
Re: [Haskell-cafe] A language that runs on the JVM or .NET has the advantage of Oracle Microsoft making those layers more parallelizable.
On Sat, 30 Jul 2011, KC wrote: Are there plans a foot (or under fingers) to make a version of Haskell that runs on the JVM? http://www.haskell.org/haskellwiki/GHC:FAQ#Why_isn.27t_GHC_available_for_.NET_or_on_the_JVM.3F ___ Haskell-Cafe mailing list Haskell-Cafe@haskell.org http://www.haskell.org/mailman/listinfo/haskell-cafe
Re: [Haskell-cafe] A language that runs on the JVM or .NET has the advantage of Oracle Microsoft making those layers more parallelizable.
No, there aren't. At least none that I know of. Don Stewart did work years ago on a JVM backend for GHC for his Bachelors thesis. You may be able to find it online (I don't know the name, sorry.) This was never integrated mainline however. These questions have been asked many many times, but the real answer is it's a whole lot of work. Not impossible, but a whole lot of work. And it's not clear what the ultimate tradeoffs are. See this for some more info: http://www.haskell.org/haskellwiki/GHC:FAQ#.NET.2FJVM_Availability In particular I'm reminded of the story of Don Syme, F# author, who initially did work I believe for a Haskell.NET compiler, but inevitably abandoned it and went to create F#. See some of the history behind F#, SML.NET and Haskell.NET here: http://www.infoq.com/interviews/F-Sharp-Don-Syme# In particular you can just look at Don's answers to the related questions. Hope it helps. On Sat, Jul 30, 2011 at 5:07 PM, KC kc1...@gmail.com wrote: Are there plans a foot (or under fingers) to make a version of Haskell that runs on the JVM? -- -- Regards, KC ___ Haskell-Cafe mailing list Haskell-Cafe@haskell.org http://www.haskell.org/mailman/listinfo/haskell-cafe -- Regards, Austin ___ Haskell-Cafe mailing list Haskell-Cafe@haskell.org http://www.haskell.org/mailman/listinfo/haskell-cafe
Re: [Haskell-cafe] (no subject)
On Sat, 2011-07-30 at 15:07 -0700, KC wrote: A language that runs on the JVM or .NET has the advantage of Oracle Microsoft making those layers more parallelizable. On top of the answers you've got regarding whether this exists, let me warn you against making assumptions like the above. There are certainly good reasons for wanting Haskell to run on the JVM or CLR, but parallelism doesn't look like one of them. The problem is that the cost models of things on the JVM or CLR are so different that if you directly expose the threading and concurrency stuff from the JVM or CLR, you're going to kill all the Haskell bits of parallelism. A huge contribution of Haskell is to have very light-weight threads, which can be spawned cheaply and can number in the tens of thousands, if not hundreds of thousands. If you decide that forkIO will just spawn a new Java or CLR thread, performance of some applications will change by orders of magnitude, or they will just plain crash and refuse to run. Differences of that scope are game-changing. So you risk, not augmenting Haskell concurrency support by that of the JVM or CLR, but rather replacing it. And that certainly would be a losing proposition. Maybe there's a creative way to combine advantages from both, but it will require something besides the obvious one-to-one mapping of execution contexts. -- Chris ___ Haskell-Cafe mailing list Haskell-Cafe@haskell.org http://www.haskell.org/mailman/listinfo/haskell-cafe
Re: [Haskell-cafe] XCode Dependency for HP on Mac
Hiho - I'm the maintainer of the Mac installer for HP. I thought I'd chime in a bit: On Mac OS X, developer tools is essentially synonymous with Xcode. That is, to get the set of standard utilities needed for development on compiled executables (notably the binutils), you install Xcode. True, it also includes the IDE called Xcode, but the vast bulk of that installation are things like headers, link libraries, command line tools, and other utilities for development of compiled executables in general. As several have pointed out, you can download Xcode for free. If you have Lion, you can get Xcode 4 for free from the Mac Store. Xcode 3 for 10.6 and 10.5. Traditionally, Apple has included Xcode on one of the CD-ROMs that came with a new computer, and/or as an installer already present on the hard disk. (I haven't bought a new Air... yet... but perhaps someone can check to see if the Xcode installer is one the SSD volume already?) It is conceivably possible to build and distribute some of those tools, but not the whole bundle. But the difficulty of getting such a build just right, and all the pieces in the right place, seems absurd to attempt to recreate when Apple has done it, and gives it away for free. Apple's versions of bintools also includes many extensions extra options for the OS X environment (like supporting multi-arch binaries) Finally, there is also licensing questions regarding the parts supplied by the OS vendor (headers, stub libs, debug libs, etc) Given the above, perhaps it is a little more clear why we choose to not include the system development tools in the Haskell Platform installer. - Mark ___ Haskell-Cafe mailing list Haskell-Cafe@haskell.org http://www.haskell.org/mailman/listinfo/haskell-cafe
Re: [Haskell-cafe] Fwd: shootout
Good Evening, can anybody confirm that this implementation is somewhat faster than the current benchmark (at expense of memory consumption)? Cheers, Thorsten On 30.07.2011 23:08, Ben wrote: hello cafe-istas -- for those of you who are into these things, a lot of the shootout programs are suffering from make errors and thus do not have benchmarks. http://shootout.alioth.debian.org/u64q/haskell.php best, ben Begin forwarded message: From: Don Stewart don...@gmail.com Date: July 30, 2011 9:52:12 AM PDT To: Ben midfi...@gmail.com Cc: Don Bruce Stewart d...@cse.unsw.edu.au Subject: Re: shootout Best to bring this up on haskell-cafe@ On Sun, Jul 31, 2011 at 12:34 AM, Ben midfi...@gmail.com wrote: FYI, a lot of the haskell programs on the shootout suffer from make errors and thus do not have benchmarks. best, ben ___ Haskell-Cafe mailing list Haskell-Cafe@haskell.org http://www.haskell.org/mailman/listinfo/haskell-cafe {-# LANGUAGE BangPatterns #-} module Main where import System.Environment import qualified Data.ByteString.Lazy as L import qualified Data.ByteString.Lazy.Char8 as C import qualified Data.ByteString as S import Data.ByteString.Internal import Data.Word -- Look Up Table data P = P !Word8 !Float type LUT = [P] iubs, homs :: LUT iubs = cdf [('a',0.27),('c',0.12),('g',0.12),('t',0.27),('B',0.02) ,('D',0.02),('H',0.02),('K',0.02),('M',0.02),('N',0.02) ,('R',0.02),('S',0.02),('V',0.02),('W',0.02),('Y',0.02)] homs = cdf [('a',0.3029549426680),('c',0.1979883004921) ,('g',0.1975473066391),('t',0.3015094502008)] -- compile LUT from assoc list cdf :: [(Char,Float)] - LUT cdf ls = reverse $ cdf' [] 0 ls where cdf' acc _ [] = acc cdf' acc !c ((v,k):ls) = cdf' ((P v' c'):acc) c' ls where !c' = k + c !v' = c2w v -- extract Char from List by Key choose :: LUT - Float - Word8 choose lut !f = choose' lut where choose' ((P v k):ls)| f = k = v | otherwise = choose' ls -- PRNG im, ia, ic :: Int im = 139968 ia = 3877 ic = 29573 data R = R !Float !Int imd :: Float imd = fromIntegral im rand :: Int - R rand seed = R newran newseed where !newseed = (seed * ia + ic) `rem` im !newran = (fromIntegral newseed) / imd -- /PRNG -- Write properly aligned output fasta !n s | n = 60 = go ts t n 60 | otherwise = go ts t n n where (t:ts) = L.toChunks s go ss s !n !m | n == 0 = return () | ll m = S.putStr l go (tail ss) (head ss) (n-ll) (m-ll) | ll == m n' = 60 = S.putStrLn l go ss r n' 60 | ll == m n' 60 = S.putStrLn l go ss r n' n' where (l,r) = S.splitAt m s ll = S.length l !n' = n-m -- build cache from PRNG data Q = Q !Int !Int cacheUF ls = L.unfoldr go $ Q 42 139968 where go (Q _ 0) = Nothing go (Q sd n) = Just (choose ls f, Q s (n-1)) where (R f s) = rand sd alu = C.pack GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\ \GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\ \CCAGCCTGGCCAACATGGTGAAAGTCTCTACTAT\ \ACATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\ \GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\ \AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\ \AGCCTGGGCGACAGAGCGAGACTCCGTCTCA fastas n = do putStrLn ONE Homo sapiens alu fasta (n*2) $ L.cycle alu putStrLn TWO IUB ambiguity codes fasta (n*3) $ L.cycle $ cacheUF iubs putStrLn THREE Homo sapiens frequency fasta (n*5) $ L.drop d $ L.cycle $ cacheUF homs where d = fromIntegral (n*3) `mod` 139968 main = do n - getArgs = readIO . head fastas n ___ Haskell-Cafe mailing list Haskell-Cafe@haskell.org http://www.haskell.org/mailman/listinfo/haskell-cafe