I'm going to stab at understanding your problem. Correct me where I'm wrong.
On Sat, Dec 12, 2009 at 12:45 PM, Ernesto <e.pica...@unical.it> wrote: > As I wrote I start with an input file. It contains a string of > variable length (10e7-10e8). This string consists of four different > characters (A,C,G,T), the bases of a DNA molecule. > The format of the input file is: > > >scaffold_0 > AGCAGTGACAGATGACAGATGACAGATGACAGTGAC > AGCAGTGACAGATGACAGATGACAGATGACAGTGAC > AGCAGTGACAGATGACAGATGACAGATGACAGTGAC > ... until 10e8 characters > > Each character or base can be associated to a specific position. The > first A has position 1, the second G 2 and so on. > > Using pytables I can store all characters base by base in a structure > like the following: > > (1, A) > (2, G) > ... and so on Continuing with "…and so on" does this mean that C, A, G, T in the above sequence get stored as 3, 4, 5, 6 or as 3, 1, 2, 4. That is, the "position" literally means the position in the DNA sequence string or are you counting how many of each base you have? > Then I have a second file in which there are other strings and related > positions. Reading this file, I have to update the table according to > the position. > For example I read the at the position 2 I have another G, at position > 3 a C, at position 1 a G. According to the position I can associate: > > (1, A) --> G > (2, G) --> G > (3, C) --> C > > I can read the same position more than time, a variable number of time. > > (1, A) --> GGGGAAAAAAAAAAA > (2, G) --> GGGGGGCGGG > (3, C) --> CCCCC > Again, I'm confused by the position. Are you trying to match up bases together (doesn't look like it) or match up positions in each file? And if it's the latter, where does the variable length come from given that each file of 1e8 bp should have at least positions 1-3, no? What is the sequence contained in the second file? It's hard to follow how the bases get assigned to these positions without it. If possible, can you provide a few sequences that are around 10-15 bp in length and work through a full example of what you would like your tables and vlarrays to look like in the end? Hopefully that will help us sort it out. Faisal ------------------------------------------------------------------------------ Return on Information: Google Enterprise Search pays you back Get the facts. http://p.sf.net/sfu/google-dev2dev _______________________________________________ Pytables-users mailing list Pytables-users@lists.sourceforge.net https://lists.sourceforge.net/lists/listinfo/pytables-users
