Re: [R] position of a specific character

On Mon, 14 Jul 2008, Erik Iverson wrote: gregexpr(\\(, frg) Better gregexpr((, frg, fixed=TRUE) (there is no regular expression here), but in this case which(unlist(strsplit(frg, )) == () is more efficient (especially if you want to do further manipulations on the individual

[R] Proxy again, this time on a Mac

Hi! My problem: i can't use the automatic package installation via the GUI since I am behind a Proxy. I tried installing Authoxy which solved the Problem for some other programs but not for R. I'm really new to R and Mac and therefore a bit confused... I can't find any internet connection

[R] enscript states file for R scripts?

Hi group! GNU enscript is a free (as in freedom) text file decorator, which among other features can highlight source code files. The language syntax descriptions are provided via special states files. The standard distribution contains states files for the most popular languages (C, C++, Pascal,

[R] Supressing printing from a function: ecdf

Dear R Users, I am trying to suppress the information printed by the ecdf function during an assignment. Various alternatives have failed me so far: a=summary(ecdf(rnorm(100)))[1st Qu.] Empirical CDF:100 unique values with summary invisible(a=summary(ecdf(rnorm(100)))[1st Qu.]) Empirical

Re: [R] Supressing printing from a function: ecdf

If you do: getAnywhere('summary.ecdf') you will see the 'cat' statement that is doing the printing that is annoying you. It seems to me that a better definition of the function would have an argument called something like 'verbose' that controlled if the 'cat' statement was executed. I'm not

Re: [R] Proxy again, this time on a Mac

On Tue, 15 Jul 2008, LostInTimeAndSpace wrote: Hi! My problem: i can't use the automatic package installation via the GUI since I am behind a Proxy. I tried installing Authoxy which solved the Problem for some other programs but not for R. I'm really new to R and Mac and therefore a bit

Re: [R] meaning of tests presented in anova(ols(...)) {Design package}

Hi Dylan, I am curious about how to interpret the table produced by anova(ols(...)), from the Design package. Frank will perhaps come in with more detail, but if he doesn't then you can get an understanding of what's being tested by doing the following on the saved object from your OLS call

Re: [R] enscript states file for R scripts?

An alternative to enscript is highlight, http://www.andre-simon.de/doku/highlight/en/highlight.html, which does come with R highlighting built in. Hadley On Tue, Jul 15, 2008 at 2:57 PM, [EMAIL PROTECTED] [EMAIL PROTECTED] wrote: Hi group! GNU enscript is a free (as in freedom) text file

Re: [R] Supressing printing from a function: ecdf

On Tue, 15 Jul 2008, Patrick Burns wrote: If you do: getAnywhere('summary.ecdf') you will see the 'cat' statement that is doing the printing that is annoying you. It seems to me that a better definition of the function would have an argument called something like 'verbose' that controlled if

Re: [R] Supressing printing from a function: ecdf

Hello Since the summary.ecdf function first do a cat, and then calls summary(knots(object),...) , I guess you will obtain the same result without the printing, by just use the latter part of the summary.ecdf function like this: a - summary(knots(ecdf(rnorm(100[1st Qu.] Hope this helps

[R] Odd behavior of remove command

Colleagues, I have encountered the following problem using R2.7.0 in Windows (Vista). I want to delete a series of functions before I close an R session. I execute the following commands from a script: FunctionsToDelete - c(function1, function2, function3) for (EachFunction in

Re: [R] long data frame selection error

Seems to work fine for me. Short version is at the end: for (i in 4:368){ + assign(paste(V, i, sep=''), 1:10) + } Temp - data.frame(V4, V5, V6, V7, V8, V9, V10, V11, V12, V13, V14, V15, + V16, V17, V18, V19, V20, V21, V22, V23, V24, V25, V26, V27, V28, V29, V30, + V31, V32, V33, V34, V35,

Re: [R] Function to create variables with prefix

Example: myfunction - function(mydata, myvariables, prefix=norm_){ newnames - paste(prefix, myvariables, sep=) mydata[newnames] - scale(mydata[myvariables]) mydata } mydata - data.frame(a=1:2, b=3:2) myfunction(mydata, c(a, b)) Moira Burke wrote: Hi. I'm a new R user

Re: [R] Supressing printing from a function: ecdf

Many thanks all for the response, this worked. Hi Martin, the verbose recommendation below would be very useful if this could be considered for a future release of stats/ecdf. Regards, Tolga Ivar Herfindal [EMAIL PROTECTED] 15/07/2008 10:38 Please respond to [EMAIL PROTECTED] To Patrick

Re: [R] modeling binary response variables

thanks Simon Blomberg-4 wrote: Jim Lindsey's repeated package has the function gnlmm which will fit beta regressions with a random intercept and one level of nesting. I don't know of any other options. Cheers, Simon. Not sure On Mon, 2008-07-14 at 19:16 -0700, Daniel Malter

Re: [R] Assoociative array?

I am not sure what your data looks like. Do 'str(sc)' to show the structure. I created a set and this is what I got: x - list(sc,sc,sc,sc) x [[1]] DayOfYear Quantity Fraction Category SubCategory 1 1 82 3.903927e-05 (Unknown) (Unknown) 2 2 78 3.713492e-05

[R] tryCatch - return from function to main script

Dear helpers, I've got a main script, which calls 4 times a function on 4 different datasets respectively. This function runs nls and is located in another R script which is sourced into my main script. What I would like to have is this: If, e.g. in the 3rd call of the function, nls fails,

[R] Layers in graphs

Hi, I am trying to plot a distribution over a histogram with the polygon() function. However I have to use this function after hist() and that makes the polygon cover the histogram. I would prefer having the histogram at the top layer and the polygon as the background. Is that possible? A

Re: [R] Insurance review statistical methods

yes R has everything that TRICAST offers.. and much more Kenneth Cabrera-2 wrote: Hi R users: I will like to know if somebody works on insurance statistics (actuarial problems) and had use TRICAST, and can tell me if with all the R tools it can be build a solution like TRICAST or

Re: [R] Layers in graphs

Hi Thomas, without really knowing how your plot looks like: You could try to redraw the first plot in the same device, i.e.: #graph it hist(weights$Weight, freq=TRUE, breaks=breakpoints, main=wfiles[i]) #lines(dens) polygon(dens$x, dens$y, border=NA, col=rgb(1,0,1,0.5)) #direct into open device

[R] linear and non linear regression in 3D !

Hi All, I have to draw a best fit line in a helix that will tell the axis of the helix and a curve that will tell the curvature of the helix. I suppose I have to do linear and non linear regression in 3D space for this ? I have coordinates in following structure 'data.frame': 24 obs. of

[R] Mapping data onto 1-10 score

Hi everyone, I want to score a set of data (-ve to +ve) using a 0-10 scale. I have the data in an R matrix, so I need to add another column, containing the scores and resave. I would be grateful for suggestions on how best to do this. Thanks, rcoder -- View this message in context:

Re: [R] Layers in graphs

Thank you! Works perfectly. On Tue, Jul 15, 2008 at 1:31 PM, René Capell [EMAIL PROTECTED] wrote: Hi Thomas, without really knowing how your plot looks like: You could try to redraw the first plot in the same device, i.e.: #graph it hist(weights$Weight, freq=TRUE, breaks=breakpoints,

[R] Mapping data onto score

Hi everyone, I want to score a set of data (-ve to +ve) using a 0-10 scale. I have the data in an R matrix, so I need to add another column, containing the scores and resave. I would be grateful for suggestions on how best to do this. Thanks, rcoder -- View this message in context:

[R] playwith package crashes on Mac

Dear R-helpers, I tried the playwith packages for the first time, and it crashed R: require(playwith) Loading required package: playwith Loading required package: lattice Loading required package: grid Loading required package: gWidgets Loading required package: gWidgetsRGtk2 Loading required

Re: [R] Assoociative array?

It seems the R console took them out. Here is hat I tried: for(i in 1:length(sc)) + { + sum(sc[[i]]]$Quantity) Error: unexpected ']' in: { sum(sc[[i]]] } Error: unexpected '}' in } What I entered is in the sum that is after the '+' Thank you. Kevin jim holtman [EMAIL

[R] Exporting an list()

Hi, I have an list() like this: $VAR1 Num Perc media stdev min P5P10P25 1 4381 56.35 181.35 39.81 87.13 123.05 132.59 152.95 2 1628 20.94 192.83 43.76 87.13 125.09 138.78 162.04 3786 10.11 197.23 50.65 88.16 120.46 136.62 159.33 4980 12.60 170.90 38.34 86.98

Re: [R] Assoociative array?

I think I had an extra '[', ']'. My mistake on this one. Thank you. Kevin [EMAIL PROTECTED] wrote: With my data I get sc[[(Unknown).{Unknown)]] returns NULL but sc[[1]] returns DayOfYear Quantity Fraction Category SubCategory 1 1 82 3.903927e-05

Re: [R] Exporting an list()

Maybe you can use the dput: x - list(VAR1 = data.frame(x=rnorm(10), y=rnorm(10)), VAR2 = data.frame(x=rnorm(10), y=rnorm(10))) dput(x, file='list.txt') x - source('list.txt')[[1]] On Tue, Jul 15, 2008 at 10:10 AM, Leandro Marino [EMAIL PROTECTED] wrote: Hi, I have an list() like

Re: [R] enscript states file for R scripts?

On 15 July 2008 at 17:23, hadley wickham wrote: | An alternative to enscript is highlight, | http://www.andre-simon.de/doku/highlight/en/highlight.html, which does | come with R highlighting built in. Another alternative is GNU a2ps which has definitions for R source, documentation and

Re: [R] Exporting an list()

Dear Leandro, Another option could be sink(). See ?sink for more information. Here is an example: x = list(VAR1 = data.frame(x=rnorm(10), y=rnorm(10)), VAR2 = data.frame(x=rnorm(10), y=rnorm(10))) sink(C:/list1.txt) x sink() HTH, Jorge On Tue, Jul 15, 2008 at 9:10 AM, Leandro

Re: [R] manipulating (extracting) data from distance matrices

Not really, I'd actually want f[4:6,4:6] to get comparisons of observations 4 to 6 only. And I'm still left with the upper triangular matrix. This is a problem since I want to sum the distances over the blocks that I am extracting. Then again, I could just divide the sum by two and get the

Re: [R] Random Forest %var(y)

Better late than never, I suppose: The second column is simply the first column divided by the variance of the response that have been OOB up to that point (20 trees), times 100. Best, Andy From: David Katz The verbose option gives a display like: rf.500 - +

[R] Problem installing R on openSUSE 10.3

Dear All, I am trying to install R 2.7 on my openSUSE 10.3. I have faithfully followed instruction at http://cran.r-project.org/bin/linux/suse/ReadMe.txt. I have downloaded all the RPMs but still R complains about: libtcl8.4.so is needed by R-base-2.7.1-6.1.i586 I searched for this library

Re: [R] playwith package crashes on Mac

Dear Professor Kubovy I do not have a Mac to test it on, but please try this: library(cairoDevice) Cairo() grid::grid.newpage() I expect that you will see a similar crash; if so, it would seem to be a problem with your GTK+ libraries. I have heard that you need to have Apple X11 installed (from

[R] DOE for logistic models

Hello everyone, Is there any tools to build experimental designs for logistic models? Thanks, Jérémy Mazet Département Génie des procédés SOREDAB La Tremblaye 78125 La Boissière Ecole Tel : 01 34 94 37 09 [[alternative HTML version deleted]]

Re: [R] randomForest outlier

Still the same question: Birgitle wrote: I try to use ?randomForest to find variables that are the most important to divide my dataset (continuous, categorical variables) in two given groups. But when I plot the outlier: plot(outlier(rfObject, cls=groupingVariable),

Re: [R] long data frame selection error

You are not selecting the headers (column names)of a dataframe. You seem to be creating a new data.frame consisting of those names. It should give you a 1Xn dataframe. Is that what you intended to do? What errors message do you get at V188? --- On Mon, 7/14/08, Rheannon [EMAIL PROTECTED]

[R] extracting elements from print object of Manova()

Hi there, Does anyone know how to extract elements from the table returned by Manova()? Using the univariate equivalent, Anova(), it's easy: a.an-Anova(lm(y~x1*x2)) a.an$F This will return a vector of the F-values in order of the terms of the model. However, a similar application using

[R] Regression problem

Hello all, I am new to r programmeand need help. I want to do multiple linear regression analysis. say, I have two matrix 'x' and 'y'. I want, 'x' as my response variable and 'y' as predictor. Each time one column of 'x' will be the response, say x[,1], then next x[,2] and so on.

[R] Font quality in base graphics

I am attempting to get publication quality graphs using R on Ubuntu. I encounter lots of problems in using cex to control font size: for instance cex=1.5 results in very blocky characters. I then tried to use res=1200 while creating a PNG file, hoping that this would solve the problem, but it did

Re: [R] Regression problem

That can be accomplished with 8 keystrokes. A hint is to do the 4 keystrokes: ?lm Patrick Burns [EMAIL PROTECTED] +44 (0)20 8525 0696 http://www.burns-stat.com (home of S Poetry and A Guide for the Unwilling S User) Angila Albaros wrote: Hello all, I am new to r programmeand

Re: [R] enscript states file for R scripts?

On 15 июл, 13:23, hadley wickham [EMAIL PROTECTED] wrote: An alternative to enscript is highlight,http://www.andre-simon.de/doku/highlight/en/highlight.html, which does come with R highlighting built in. Hadley Thanks for pointing this out. But I think I actually need enscript

[R] counting number of G in TCGGGGGACAATCGGTAACCCGTCT

Any better solution than this ? sum(strsplit(TCGACAATCGGTAACCCGTCT, )[[1]] == G) _ [[alternative HTML version deleted]] __ R-help@r-project.org mailing list

Re: [R] counting number of G in TCGGGGGACAATCGGTAACCCGTCT

Daren Tan daren76 at hotmail.com writes: Any better solution than this ? sum(strsplit(TCGACAATCGGTAACCCGTCT, )[[1]] == G) Try table(strsplit(TCGACAATCGGTAACCCGTCT, )) A C G T 5 7 8 5 and get all 4 at once. HTH -- Ken Knoblauch Inserm U846 Institut Cellule Souche et Cerveau

Re: [R] counting number of G in TCGGGGGACAATCGGTAACCCGTCT

Seems like you can do: library(matchprobes) # on Bioconductor countbases(TCGACAATCGGTAACCCGTCT)[,G] The catch is that it only counts A, C, G, and T:s and no other symbols. /Henrik On Tue, Jul 15, 2008 at 8:27 AM, Daren Tan [EMAIL PROTECTED] wrote: Any better solution than this ?

Re: [R] manipulating (extracting) data from distance matrices

Maybe dmat-dist(dat, method=euclidean,upper = TRUE,diag = TRUE) can fix your problem with the triangular matrix? Cheers Jon Michael Rennie wrote: Not really, I'd actually want f[4:6,4:6] to get comparisons of observations 4 to 6 only. And I'm still left with the upper triangular matrix.

Re: [R] manipulating (extracting) data from distance matrices

The ecodist package has a convenience function full() that converts a dist object to a symmetric matrix. After that subsetting works normally. lower() performs the reverse operation. Sarah -- Sarah Goslee http://www.functionaldiversity.org __

Re: [R] manipulating (extracting) data from distance matrices

Hi Jon, That only controls the print display of the matrix, not how one can access the elements. I think my solution revolves around indexing in as.matrix() with a mind to the fact that results will be duplicated along the diagonal. Cheers, and thanks all, Mike On Tue, Jul 15, 2008 at 11:43

Re: [R] counting number of G in TCGGGGGACAATCGGTAACCCGTCT

Hi, And the Bioconductor package Biostrings is the place to go for any serious work with sequences. -- Best wishes Wolfgang -- Wolfgang Huber EBI/EMBL Cambridge UK http://www.ebi.ac.uk/huber 15/07/2008 16:43 Henrik Bengtsson

Re: [R] counting number of G in TCGGGGGACAATCGGTAACCCGTCT

Henrik, As Wolfgang mentioned, the Biostrings package in Bioconductor has a number of sequence manipulation functions. The alphabetFrequency function would get you what you need. library(Biostrings) alphabetFrequency(DNAString(TCGACAATCGGTAACCCGTCT)) A C G T M R W S Y K V H D B N - + 5

[R] Calculating Stream Metabolism

are there any packages that calculate stream metabolism. thanks Stephen -- Let's not spend our time and resources thinking about things that are so little or so large that all they really do for us is puff us up and make us feel like gods. We are mammals, and have not exhausted the annoying

[R] sunrise sunset calculations

Does anyone know if there is a sunrise sunset calculator for R? -- Let's not spend our time and resources thinking about things that are so little or so large that all they really do for us is puff us up and make us feel like gods. We are mammals, and have not exhausted the annoying little

Re: [R] Problem installing R on openSUSE 10.3

Hi, I didn't try automatic dependency resolution instead installed each library one by one. It seems that tcl is installed and the libtcl8.4.so exists. Below is the info from the system: rpm -q tcl tcl-8.4.15-22 whereis libtcl8.4.so libtcl8.4: /usr/lib64/libtcl8.4.so rpm -i

[R] aov error with large data set

I'm looking to analyze a large data set: a within-Ss 2*2*1500 design with 20 Ss. However, aov() gives me an error, reproducible as follows: id = factor(1:20) a = factor(1:2) b = factor(1:2) d = factor(1:1500) temp = expand.grid(id=id, a=a, b=b, d=d) temp$y = rnorm(length(temp[, 1])) #generate

Re: [R] sunrise sunset calculations

On 7/15/2008 12:52 PM, stephen sefick wrote: Does anyone know if there is a sunrise sunset calculator for R? RSiteSearch(sunrise, restrict=function) points to several related functions in the maptools package. -- Chuck Cleland, Ph.D. NDRI, Inc. (www.ndri.org) 71 West 23rd Street, 8th floor

[R] Iterations

I have a command that reads in some data: x - read.csv(Sales2007.dat, header=TRUE) Then I try to organize the data: sc - split(x, list(x$Category, x$SubCategory), drop=TRUE) Then I want to iterate through the data. I was able to get the following to run on the R console: for(i in

Re: [R] Problem installing R on openSUSE 10.3

On Tue, 15 Jul 2008 07:08:24 -0700 (PDT) A Ezhil [EMAIL PROTECTED] wrote: Dear All, I am trying to install R 2.7 on my openSUSE 10.3. I have faithfully followed instruction at http://cran.r-project.org/bin/linux/suse/ReadMe.txt. I have downloaded all the RPMs but still R complains about:

Re: [R] counting number of G in TCGGGGGACAATCGGTAACCCGTCT

Daren, Not sure if it is any easier, but another solution is: code - unlist(strsplit(TCGACAATCGGTAACCCGTCT,)) length(grep([G],code)) Steve -Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of Daren Tan Sent: Tuesday, July 15, 2008 11:28 AM To:

Re: [R] Iterations

Kevin, By default, many functions only *return* a result, they don't explicitly *print* it. There is no difference in interactive mode, but there is in batch mode (e.g., in loops). Use print() or cat() for explicit printing to console. for(i in 1:100) { cat(i,\n) } HTH, Stephan

Re: [R] sunrise sunset calculations

Is there a way to use a time zone independant in the sunriset function. We have kept our instruments on eastern standard time. Any help would be great! On Tue, Jul 15, 2008 at 1:06 PM, Chuck Cleland [EMAIL PROTECTED] wrote: On 7/15/2008 12:52 PM, stephen sefick wrote: Does anyone know if

Re: [R] Regression problem

On Tue, Jul 15, 2008 at 10:25 AM, Patrick Burns [EMAIL PROTECTED] wrote: That can be accomplished with 8 keystrokes. A hint is to do the 4 keystrokes: ?lm Umm - unless you are counting the implicit Enter, that's only 3 keystrokes isn't it? Angila Albaros wrote: Hello all,

Re: [R] Iterations

[EMAIL PROTECTED] wrote: I have a command that reads in some data: x - read.csv(Sales2007.dat, header=TRUE) Then I try to organize the data: sc - split(x, list(x$Category, x$SubCategory), drop=TRUE) Then I want to iterate through the data. I was able to get the following to run on the R

Re: [R] Iterations

for(1 in 1:10) { print(i) } Mike On Tue, Jul 15, 2008 at 1:11 PM, [EMAIL PROTECTED] wrote: I have a command that reads in some data: x - read.csv(Sales2007.dat, header=TRUE) Then I try to organize the data: sc - split(x, list(x$Category, x$SubCategory), drop=TRUE) Then I

[R] Help with maptools sunriset()

library(maptools) RM215 - matrix(c(33.5959109, -82.1461363), nrow=1) RM215.sp - SpatialPoints(RM215, proj4string=CRS(+proj=longlat +datum=WGS84)) d060101 - as.POSIXct(2006-01-01) study_seq - seq(from=d060101, length.out=761, by=days) up - sunriset(RM215, study_seq, direction=sunrise,

Re: [R] Iterations

Oops, typo- sorry, should be for(i in 1:10) { print(i) } Mike On Tue, Jul 15, 2008 at 1:39 PM, Michael Rennie [EMAIL PROTECTED] wrote: for(1 in 1:10) { print(i) } Mike On Tue, Jul 15, 2008 at 1:11 PM, [EMAIL PROTECTED] wrote: I have a command that reads in

Re: [R] Iterations

If you read the help page, ?for, you might have seen under Value, that 'for', 'while' and 'repeat' return the value of the last expression evaluated (or 'NULL' if none was), invisibly. So if you want to see the values, print() them. In general, from the first part of your message, it

Re: [R] Font quality in base graphics

willemf wrote on 07/15/2008 08:42 AM: I am attempting to get publication quality graphs using R on Ubuntu. I encounter lots of problems in using cex to control font size: for instance cex=1.5 results in very blocky characters. I then tried to use res=1200 while creating a PNG file, hoping that

Re: [R] Regression problem

Douglas Bates wrote: On Tue, Jul 15, 2008 at 10:25 AM, Patrick Burns [EMAIL PROTECTED] wrote: That can be accomplished with 8 keystrokes. A hint is to do the 4 keystrokes: ?lm Umm - unless you are counting the implicit Enter, that's only 3 keystrokes isn't it? You give away that you're

[R] INSEED Statistics Workshop on Bayesian statistics using OpenBUGS and R

Dear Friends, INSEED announces following workshop this year. Bayesian statistics using OpenBUGS and R to be organised at the Department of Statistics, St. Thomas College, Pala, Kerala from 08-12 December, 2008. This is the second workshop of its kind. For details, see the workshop website

Re: [R] extracting elements from print object of Manova()

Dear Michael, Does it work for you? tear - c(6.5, 6.2, 5.8, 6.5, 6.5, 6.9, 7.2, 6.9, 6.1, 6.3, 6.7, 6.6, 7.2, 7.1, 6.8, 7.1, 7.0, 7.2, 7.5, 7.6) gloss - c(9.5, 9.9, 9.6, 9.6, 9.2, 9.1, 10.0, 9.9, 9.5, 9.4, 9.1, 9.3, 8.3, 8.4, 8.5, 9.2, 8.8, 9.7, 10.1, 9.2) opacity - c(4.4,

[R] INSEED statistics workshop on Statistical Models and Practices in Epidemiology (using R)

Dear Friends, INSEED announces following workshop this year. Statistical Models and Practices in Epidemiology (using R) to be organised jointly with the Department of Statistics, Manipal University, Karnataka from 24-28 November, 2008. For details, see the workshop website

[R] code reduction (if anyone feels like it)

# I am sure that I could be more efficient than this but how? Thanks in advance. #GPS in Decimal Degrees in the form longitude latitude RM215 - matrix(c(-82.1461363, 33.5959109), nrow=1) SC - matrix(c(-82.025888, 33.606454), nrow=1) RM202 - matrix(c(-81.9906723, 33.5027653), nrow=1) RM198 -

Re: [R] Iterations

Sorry I missed the print part. When nothing was output I assumed that nothing happened. Thank you. Kevin Erik Iverson [EMAIL PROTECTED] wrote: If you read the help page, ?for, you might have seen under Value, that 'for', 'while' and 'repeat' return the value of the last

Re: [R] Iterations

Thank you. ?for just gives me a + rompt indicating that I need to supply more input. The same with ?while and ?repeat. Help(for) yelds: help(for) Error: unexpected ')' in help(for) But thanks for the tip. Keivn Erik Iverson [EMAIL PROTECTED] wrote: If you read the help page, ?for,

[R] POSIXct extract time

RM215.sp - SpatialPoints(RM215, proj4string=CRS(+proj=longlat +datum=WGS84)) d060101 - as.POSIXct(2006-01-01, tz=EST) study_seq - seq(from=d060101, length.out=761, by=days) up.215 - sunriset(RM215.sp, study_seq, direction=sunrise, POSIXct.out=TRUE) down.215 - sunriset(RM215.sp, study_seq,

[R] generalized spatial autoregressive lag model

R 2.7, WinXP Hi, I am interested in estimating the spatial autoregressive lag model y = rWy +Xb + e where W is a square matrix of weights, r an autocorrelation parameter, b a vector of coefficients, X a matrix of covariates. There are several packages in R that can estimate this model (sna,

Re: [R] POSIXct extract time

Try this: format(down.215$time, %H:%M:%S) On Tue, Jul 15, 2008 at 4:50 PM, stephen sefick [EMAIL PROTECTED] wrote: RM215.sp - SpatialPoints(RM215, proj4string=CRS(+proj=longlat +datum=WGS84)) d060101 - as.POSIXct(2006-01-01, tz=EST) study_seq - seq(from=d060101, length.out=761, by=days)

Re: [R] POSIXct extract time

sorry this should work On Tue, Jul 15, 2008 at 3:50 PM, stephen sefick [EMAIL PROTECTED] wrote: RM215 - matrix(c(-82.1461363, 33.5959109), nrow=1) RM215.sp - SpatialPoints(RM215, proj4string=CRS(+proj=longlat +datum=WGS84)) d060101 - as.POSIXct(2006-01-01, tz=EST) study_seq -

Re: [R] Font quality in base graphics

Hi wf I just cannot believe that R does not have a good command of this. Curious. I find R's graphical output matchless. Almost without exception I use postscript and find the controls available under base graphics (?par) or lattice adequate (to understate). Very occassionally I fiddle with

Re: [R] Iterations

Sorry, I'm in ESS. Try ?Control [EMAIL PROTECTED] wrote: Thank you. ?for just gives me a + rompt indicating that I need to supply more input. The same with ?while and ?repeat. Help(for) yelds: help(for) Error: unexpected ')' in help(for) But thanks for the tip. Keivn Erik Iverson

Re: [R] Iterations

-Original Message- From: [EMAIL PROTECTED] [mailto:[EMAIL PROTECTED] On Behalf Of [EMAIL PROTECTED] Sent: Tuesday, July 15, 2008 12:40 PM To: Erik Iverson Cc: [EMAIL PROTECTED] Subject: Re: [R] Iterations Thank you. ?for just gives me a + rompt indicating that I need to

[R] sem testing multiple hypotheses with BIC

I'm coming from the AMOS world and am wondering if there is a simple way to do multiple hypothesis testing in the manner of BIC analyses in AMOS using the sem package in R. I've read the documentation, but don't see anything in there except for basic BIC scores. Perhaps someone has devised a

Re: [R] .First and .Rprofile won't run on startup

Thanks to everyone for the help and advice! It turns out that my problem was using $HOME in the .First function in Rprofile.site. Since $HOME is a user specific variable, it seems to have crashed when running from the $R_HOME/etc/ directory. I added the other .Rprofile files without deletng the

[R] how to get confidential interval for classification accuracy using 10-fold validation in svm package

I am just starting to use R language, and jumped into using svm (e1071) model to do classification analysis using svm. Meanwhile, I used 10-fold cross validation to evaluate initial classification accuracy. Now I am going to run for example 100 times cross validation to determine the distribution

Re: [R] Font quality in base graphics

Thank you Jeff, I will follow up on this. I just cannot believe that R does not have a good command of this. The obvious route is Postscript ourput, since it is not raster-based and one can incorporate EPS files into OpenOffice documents. However, when printing to a Postscript device, there is no

Re: [R] matplot help

Thank you both. I managed to accomplish this tack with your help. date = ts(time, start =1985, freq =4) quarters = as.Date(time(date)) z = length(quarters) win.graph() par(mfrow=c(1,1),mex=0.7,bg=white) matplot(1:n,corp.check,type=l,lty=1, col=2, ylab=$,xlab=,xaxt=n) title(main=Checkable

Re: [R] Font quality in base graphics

willemf wrote on 07/15/2008 08:42 AM: I am attempting to get publication quality graphs using R on Ubuntu. I encounter lots of problems in using cex to control font size: for instance cex=1.5 results in very blocky characters. I then tried to use res=1200 while creating a PNG file, hoping that

Re: [R] Mapping data onto score

On Jul 15, 2008, at 8:16 AM, rcoder wrote: Hi everyone, I want to score a set of data (-ve to +ve) using a 0-10 scale. I have the data in an R matrix, so I need to add another column, containing the scores and resave. Hi, I am a little fuzzy on what you are asking, but my guess is

[R] Melt (reshape) question

Dear all, I have a grid of 720 columns by 360 rows of global population density values, and hope to convert this to column format using the 'melt' command in the 'reshape' package. I'm not receiving any errors as such, but when the code has finished running, my output looks like this:

[R] Filtering output

I have a command which returns a data fram if I am not mistaken: sc - split(x, list(x$Category, x$SubCategory), drop=TRUE) Now I wish to get the Category and SubCategory that the data was split on. So my first attempt would be: sc[[1]]$Category[1] But that yields [1] (Unknown) 46 Levels:

Re: [R] playwith package crashes on Mac

For some reason, cairoDevice has been crashing the Mac for a while. It has something to do with the rotation of text through Pango. That's all I've been able to determine. Kind of tough without access to a Mac... but it DID work once upon a time.. 2008/7/15 Felix Andrews [EMAIL PROTECTED]: Dear

Re: [R] Iterations

On 16/07/2008, at 7:40 AM, [EMAIL PROTECTED] [EMAIL PROTECTED] wrote: Thank you. ?for just gives me a + rompt indicating that I need to supply more input. The same with ?while and ?repeat. Help(for) yelds: help(for) Error: unexpected ')' in help(for) But thanks for the tip.

Re: [R] Mapping data onto score

Hi Ben, Yes, this is more or less what I want to do. I want to apply this data in columns in a matrix, and insert the results to additional columns. I am not entirely aware of a good way of doing this. e.g. take data from column B, apply normalisation, and feed output into column C Thanks,

Re: [R] Mapping data onto score

On Jul 15, 2008, at 5:16 PM, rcoder wrote: Hi Ben, Yes, this is more or less what I want to do. I want to apply this data in columns in a matrix, and insert the results to additional columns. I am not entirely aware of a good way of doing this. e.g. take data from column B, apply

Re: [R] Filtering output

?factor If all you want is the character value, then do: as.character(sc[[1]]$Category[1]) On Tue, Jul 15, 2008 at 4:37 PM, [EMAIL PROTECTED] wrote: I have a command which returns a data fram if I am not mistaken: sc - split(x, list(x$Category, x$SubCategory), drop=TRUE) Now I wish to

[R] What package to use to create a GUI

Hello dead R-experts, I work on x86_64-suse-linux and I am using R 2.7.1. I created several scripts that will be used by several people that are not familiar with R. I would like to create a GUI to call the scripts that the users would choose to run, also, the GUI should allow them to

Re: [R] What package to use to create a GUI

tcltk (which is part of the standard distribution) if you want fine control; or perhaps gWidgets will suffice. There are others (rJava, RGtk2, ...) Also check the Cran website, as there is a GUI section there. -- Bert Gunter Genentech -Original Message- From: [EMAIL PROTECTED]

Re: [R] tryCatch - return from function to main script

Can you provide an example of what you have tried. This should work: for(i in 1:4){ x - try(yourFunction(...)) if (class(x) = try-error) print('had a problem) } On Tue, Jul 15, 2008 at 6:59 AM, Anne-Marie Ternes [EMAIL PROTECTED] wrote: Dear helpers, I've got a main script, which

Re: [R] Melt (reshape) question

Thanks very much to you both - it worked a treat! Steve _ 100’s of Nikon cameras to be won with Live Search __ R-help@r-project.org mailing list

  1   2   >