On Sat, Jul 26, 2008 at 9:35 AM, Peter Dalgaard
[EMAIL PROTECTED] wrote:
Henrique Dallazuanna wrote:
Try this:
x - data.frame(A=c(10,20), B = c(a, b), C = c(20,30))
x[sapply(x, is.numeric)]
Yes, and read ?Extract to clear up the confusion between data$vol and
data[257] and data[[257]]
Hi.
On Wed, Jul 23, 2008 at 9:23 AM, Chris82 [EMAIL PROTECTED] wrote:
Hello,
I have a problem to flip a 200x200 matrix, which is imported by a .asc file.
I want to flip the matrix like in a created example below:
b - matrix(1:9,3,3,byrow=T)
b
[,1] [,2] [,3]
[1,]123
A few things that will help you, if not now then in the future:
1) Preallocate the result object. This allow you to avoid using
cbind()/rbind(), which constantly creates a new large copy in each
iteration. That will eventually bite you if you have a lot of data.
In your case you know the number
Hi,
is your question how you do this in R? Note that this is a mailing
list for R. There are probably other lists/groups better suited for
Excel-specific problems.
Cheers
Henrik
On Tue, Jul 22, 2008 at 10:59 AM, William Pepe [EMAIL PROTECTED] wrote:
In Excel, I have data that looks like
Hi,
could be a browser issue. What browser are you using? I see this
behavior on Firefox 3.0.1 but not Microsoft IE 7.0(.5730.11).
Looking at the source code for the generate search (of 'reshape') you
get the relative URL:
../../../library/R.utils/html/wrap.array.html
for both browsers. The
Seems like you can do:
library(matchprobes) # on Bioconductor
countbases(TCGACAATCGGTAACCCGTCT)[,G]
The catch is that it only counts A, C, G, and T:s and no other symbols.
/Henrik
On Tue, Jul 15, 2008 at 8:27 AM, Daren Tan [EMAIL PROTECTED] wrote:
Any better solution than this ?
m - matrix(1:40, ncol=4);
groups - rep(1:2, each=2);
uGroups - unique(groups);
mMeans - matrix(NA, nrow=nrow(m), ncol=length(uGroups));
for (gg in seq(along=uGroups)) {
mMeans[,gg] - rowMeans(m[,groups == uGroups[gg], drop=FALSE]);
}
(Preallocation of result matrix is more memory efficient than
Hi,
FYI, *the* NEWS file containing updates for all R versions is
available at http://cran.r-project.org/ - see the link 'new features
and bug fixes'. This links to the URL (which I think is rather
stable):
https://svn.r-project.org/R/trunk/NEWS
The NEWS file also comes with your R
Quick comment. Use an environment to hold your fields and then pass
around the environment variable. Any modification to variables inside
the environment done from anywhere (inside/outside functions) will be
persistent. Then wrap this up in a class structure, overload, say,
'$', '[[', '$-',
A regular set is given by [set]. The complementary set is given
by [^set] where set is a set of symbols. I don't think you have
to escape symbols in set (but I might be wrong). In any case, this
does what you want:
lines - c(abc, !abc, #abc, ^abc, #abc)
pattern - ^[^!#^];
grep(pattern,
FYI,
there is also smoothScatter() in the 'geneplotter' package (part of
the Bioconductor.org project).
/Henrik
On Tue, May 13, 2008 at 5:08 AM, Prof Brian Ripley
[EMAIL PROTECTED] wrote:
On Tue, 13 May 2008, Charles Plessy wrote:
Dear list,
I realised by chance when analysing a
help(file.info). /Henrik
On Wed, Apr 30, 2008 at 5:33 PM, Faheem Mitha [EMAIL PROTECTED] wrote:
Hi,
Is there a way to check whether a file is empty in R. I did the customary
searches, but did not find anything. Please cc me on any reply.
See help(warnings) and from there you'll also find help(warning). It
is described there.
/Henrik
On Tue, Apr 29, 2008 at 5:14 PM, Vidhu Choudhary
[EMAIL PROTECTED] wrote:
Hi All,
I want to hide all the system(R) generated warning messages and want only
the messages from my script should be
Try to write the data.frame to file in blocks of rows by calling
write.table() multiple times - see argument 'append' for
write.table(). That will probably require less memory.
/Henrik
On Tue, Apr 15, 2008 at 6:12 PM, Xiaojing Wang [EMAIL PROTECTED] wrote:
Hello, all,
First thanks in
# Setup the translation map
transMap - c(A=R, B=R, C=R, D=B, F=B);
# The input data
v3 - c(A, C, D, F, A, C, B, B, B, B, A, D);
# The translated data
v4 - transMap[v3];
df2 - data.frame(V3=v3, V4=v4);
I recommend you to read 'An Introduction to R' that comes with any R
installation. There is
library(R.oo)
example(data.frame)
example(matrix)
example(iris)
ll()
member data.class dimension objectSize
1 author character 1120
2 d data.frame c(10,3) 1136
3 d.0 data.framec(0,3)824
4 d0 data.frame c(10,0)320
5 d00
On Tue, Mar 18, 2008 at 8:46 AM, Paul Evans [EMAIL PROTECTED] wrote:
Hi,
I wanted to download a file and did the following:
-
fileLink -
'ftp://ftp.ncbi.nih.gov/pub/geo/DATA/supplementary/series/GSE1000/GSE1000_RAW.tar'
On Tue, Mar 18, 2008 at 8:57 AM, Henrik Bengtsson [EMAIL PROTECTED] wrote:
On Tue, Mar 18, 2008 at 8:46 AM, Paul Evans [EMAIL PROTECTED] wrote:
Hi,
I wanted to download a file and did the following:
-
fileLink -
'ftp
On Tue, Mar 18, 2008 at 9:10 AM, Prof Brian Ripley
[EMAIL PROTECTED] wrote:
/geodat *is* an absoute path!
The second argument of download.file is called 'destfile', so what makes
you think it is a desination *directory*?
The help file might be the source of confusion:
destfile: A character
On Sun, Mar 9, 2008 at 3:36 PM, tom soyer [EMAIL PROTECTED] wrote:
Hi,
I am currently using the following to formate numbers into percentages:
x=0.00112
paste(round(x*100,2),%,sep=)
My favorite is sprintf(), which allow you to control number of digits
at the same time you control for
Works fine for me on the same setup. Try this and compare (especially
the size of the downloaded file):
url - http://cran.uk.r-project.org/bin/windows/contrib/2.6/ada_2.0-1.zip;;
download.file(url, basename(url), mode=wb) # Note wb!!!
trying URL
On Mon, Mar 3, 2008 at 1:25 AM, Ng Stanley [EMAIL PROTECTED] wrote:
Hi,
I consulted ?png, and it uses X11. is there any way to save plots into png,
without using X11 ?
See See also under help(png) for alternatives. Rule of thumb: If
you get a reply from BR that you don't get the first time
Hi My,
On Sat, Mar 1, 2008 at 8:04 PM, My Coyne [EMAIL PROTECTED] wrote:
I don't know if this is the correct forum to ask the following question;
however, when I search the aroma.affymetrix discussion group, it suggested
that I should posted the question to r-help. Here it goes.
I think
On Fri, Feb 29, 2008 at 2:12 PM, Louise Hoffman
[EMAIL PROTECTED] wrote:
[snip]
Seriously. Be specific if you have a problem. (read the posting guide). R
can
also plot. If you don't like R's plots (which I could not understand) you
can
export data and import them to gnuplot. So
spect2 - insert(spect1, ats=pos, values=as.list(intensities))
str(spect2)
num [1:13112] -0.457 -0.457 0.300 1.781 -0.381 ...
/Henrik
On Thu, Feb 21, 2008 at 9:26 AM, Henrik Bengtsson [EMAIL PROTECTED] wrote:
On Thu, Feb 21, 2008 at 4:30 AM, Dani Valverde [EMAIL PROTECTED] wrote:
Hello
(CIBER-BBN)
Grup d'Aplicacions Biomèdiques de la RMN
Facultat de Biociències
Universitat Autònoma de Barcelona
Edifici Cs, Campus UAB
08193 Cerdanyola del Vallès- SPAIN
+34 93 5814126
En/na Henrik Bengtsson ha escrit:
Hi.
On Feb 20, 2008 2:38 AM, Dani Valverde [EMAIL
First,
please provide us with enough unambiguous information so we don't have
to second guess that you are using qplot() in the 'ggplot' package.
Report sessionInfo() is recommended.
It has nothing to do with jpeg() or any other device driver. You get
the same problem with:
library(ggplot)
x -
Hi.
I think the devices provided in 'Cairo' package solves your problem.
[ Alternatively you can use the bitmap() device which utilizes
Ghostscript to generate bitmap images. In the 'R.utils' package there
are wrappers png2() and jpeg2() calling bitmap() but that imitates the
png() and jpeg()
Hi.
On Feb 20, 2008 2:38 AM, Dani Valverde [EMAIL PROTECTED] wrote:
Hello,
I am trying to insert a certain number of points into a certain position
of a vector with this code:
x - seq(1:10909)
x1 - c(13112-10909)
spect1 - rnorm(13112)
interpol - approx(x,spect1,xout=c(seq(from=1,
Is 'plotDensity' a specific function you are referring to? If so, in
which package? Then we can give a straight answer...
/Henrik
On Feb 19, 2008 4:10 AM, [EMAIL PROTECTED] wrote:
Hallo,
I have a question to plotDensity and do not understand what stand behind. In
a density plot the
On Thu, Feb 14, 2008 at 4:57 AM, Ng Stanley [EMAIL PROTECTED] wrote:
Hi,
I have some microarray data, cy5 and cy3 values are in log2. Is there a
way to check they have undergone lowess normalization ?
Yes, go back ask the one who you got the data from.
Honestly, this is a serious reply,
X - matrix(c(0,2,0,1,0,0,3,5), ncol=2)
Informative version:
isPositive - (X 0)
nbrOfPositives - apply(isPositive, MARGIN=1, FUN=sum)
hasPositives - (nbrOfPositives = 1)
positiveRows - which(hasPositives)
Compact version:
positiveRows - which(rowSums(X 0) = 1)
If you have an extremely large
Have a look at the smoothScatter() function in the 'geneplotter'
(Bioconductor) package. That might be sufficient for you.
Alternatively, generate a bitmap (e.g. PNG) image plot instead (at
least pdflatex can import those as is).
/Henrik
On Feb 11, 2008 2:18 AM, John Lande [EMAIL PROTECTED]
Open suggestion/question:
If you in each step of an K-step iteration load/allocate a large
object, each time of a different size, followed by smaller memory
allocations (due to your analysis), you might be better of if you
could do the iteration such that the largest object is in the first
On Feb 5, 2008 6:06 AM, Barry Rowlingson [EMAIL PROTECTED] wrote:
Duncan Murdoch wrote:
Another problem is that there are two different class systems in R:
sometimes calls S3 and S4 (because of the versions of S where they were
introduced). You were reading about S3.
There's three
- as.integer(100*xs);
print(ys);
[1] 100 101 102 103 104 105 106 107 108
[10] 109 110 111 112 112 114 114 115 117
[19] 118 119 120 121 122 123 124 125 126
[28] 127 128 129 130
Pay attention to elements 13:18(!) - subsetting using doubles is not safe.
/H
Henrik Bengtsson a écrit :
x[1:n]
/H
For text-based progress bars see the ProgressBar class in R.utils, e.g.
# A faster progress bar with default step length 1.4.
pb - ProgressBar(max=42, stepLength=1.4)
reset(pb)
while (!isDone(pb)) {
x - rnorm(3e4)
increase(pb)
Sys.sleep(0.02)
}
cat(\n)
Output:
On Jan 30, 2008 1:15 PM, Ted Harding [EMAIL PROTECTED] wrote:
On 30-Jan-08 19:47:55, Ramon Hidalgo wrote:
Hello,
How can I make the following expressions are equivalent
datos$Col1 and datos$var when I define var - Col1?
I am trying to get the same result with
datos$Col1
[1] 0 1 1
x[1:n]
/H
On Jan 29, 2008 5:07 AM, [EMAIL PROTECTED] wrote:
Seems strange to me to define an operator relatively to a very special case.
I have to admit that I do not use 1:1e7 every day :-)
Wouldn't it be more appropriate to define a a:b operator numeric (that
is preserving the initial
When and how does this happen? In Rgui or Rterm? How do you launch
R? Have you tried the obvious and restarted R? If you share the
startup messages, sessionInfo() and everything else you think could be
helpful, someone might be able to help you. There is a vanilla
options to start R, e.g.
Check your getOption(digits). Default is typically 7. Either you
or a package/function sets it to a small value. You get that
**output** with options(digits=n) where n=1,2,3.
/Henrik
On Jan 20, 2008 7:13 PM, Thomas Lumley [EMAIL PROTECTED] wrote:
On Sun, 20 Jan 2008, Brant Inman wrote:
On 14/01/2008, hadley wickham [EMAIL PROTECTED] wrote:
On Jan 14, 2008 5:48 PM, Harte, Thomas P [EMAIL PROTECTED] wrote:
i'm putting the final touches on a package that i'm developing and i
noticed
that if i detach the package, and then re-build re-install it (using R
CMD)
then I can't
the returned object without the displaying information
showed by the function. Something like suppressWarnings( ) but
suppressing the standard output.
Miguel
Henrik Bengtsson escribió:
See capture.output(). /H
On 11/01/2008, Miguel Ratón Almansa [EMAIL PROTECTED] wrote:
Hi everybody
Try the EBImage package (utilizes ImageMagick and is available via
Bioconductor.org) - not sure if it well help though. If not, try to
clip the larger image by calling ImageMagick outside R.
/HB
On 11/01/2008, Milton Cezar Ribeiro [EMAIL PROTECTED] wrote:
Dear all,
I have a so large image
On 11/01/2008, Lauri Nikkinen [EMAIL PROTECTED] wrote:
Thanks, one further question: how to order these matrices using these row
sums?
lapply(a, function(x) order(x[,5])) #produces only indeces
...which you can use as row indices 'idxs' to reorder the rows of
matrix 'x' by x[idxs,].
/Henrik
See capture.output(). /H
On 11/01/2008, Miguel Ratón Almansa [EMAIL PROTECTED] wrote:
Hi everybody,
I have to use a function that shows an output message like # nonzero
coefficients ... followed with a lot of numbers depending on the input.
This is very annoying because I have to run that
In the R.utils package there is seqToIntervals(), e.g.
print(seqToIntervals(1:10))
## from to
## [1,]1 10
print(seqToIntervals(c(1:10, 15:18, 20)))
## from to
## [1,]1 10
## [2,] 15 18
## [3,] 20 20
There is also seqToIntervals(), which uses the above, e.g.
Hi,
depending on what you do and how (and why) you save objects in RData
files in the first place, you might be interested in knowing of the
loadObject()/saveObject() methods of R.utils, as well as
loadCache()/saveCache() in R.cache.
The R.utils methods are basically clever wrappers around
Hi,
I'm sorry, but I will most likely withdraw R.huge from CRAN anytime
soon. The File***Matrix classes had some problems, which when solved
made it too slow. See BufferedMatrix package in Bioconductor instead.
/Henrik
On 09/12/2007, [EMAIL PROTECTED]
[EMAIL PROTECTED] wrote:
Hi all,
Did you try to install using install.packages()?
install.packages(caret)
Warning in install.packages(caret) :
argument 'lib' is missing: using '/scratch5/hb/R/R_LIBS/linux/library/'
trying URL 'http://cran.cnr.Berkeley.edu/src/contrib/caret_3.08.tar.gz'
Content type 'application/x-gzip'
On 06/12/2007, Loren Engrav [EMAIL PROTECTED] wrote:
As for news readers
I found R and R.mac and R.Bio on the sites you recommend, thank you very
much, they would avoid the individual emails, but then I would have to go
look at them, which might be Ok
Deluge? Well, there are from R and Bio
On Nov 20, 2007 7:04 PM, Moshe Olshansky [EMAIL PROTECTED] wrote:
You can do the following:
set1 - Matrix1[,1]
set2 - Matrix2[,1]
common - intersect(set1,set2)
ind1 - which(set1 %in% common)
ind2 - which(set2 %in% common)
A1 - Matrix1[ind1,-1]
A2 - Matrix2[ind2,-1]
Ok, this far.
and
See order(). -Henrik
On 21/11/2007, Rina Oldager Miehs [EMAIL PROTECTED] wrote:
Hello
We have a problem with sorting our dataframe...
i have tried to write
x - males[sort(males$index, decreasing=T),]
But that just gives me
x
id sex BVgain BVmeat phenogain phenomeat index
NA
Hi,
tbe R.batch package (http://www.braju.com/R/) was written to run
multiple batch jobs on one or more hosts sharing the same file system.
It doesn't do everything you want but part of it. For details, see
r-help thread 'R.batch (Was: Re: [R] Calling R from R and specifying
wait until script is
Hi.
On 11/17/07, Prof Leslie Smith [EMAIL PROTECTED] wrote:
Is there any way to read these files (standard .mat files, created by
matlab version 7 onwards are compressed)? I know that R.matlab doesn't
read them (it even says in the file MatlabServer.m Matlab v7 saves
compressed files, which
See the EBImage package on Bioconductor.org. It builds on top of
ImageMagick. /Henrik
On 10/12/07, Bio7 [EMAIL PROTECTED] wrote:
Dear R users,
in my application i can transfer images to R with the help of Rserve. The
images come from
a java application. When i plot a greyscale image
On 9/28/07, hadley wickham [EMAIL PROTECTED] wrote:
Yes there is harm. But to make bold lines, easy to read titles is fine.
See the spar function in
http://biostat.mc.vanderbilt.edu/SgraphicsHints for a starter. Also see
the setps, ps.slide, and setpdf functions in the Hmisc package.
501 - 557 of 557 matches
Mail list logo
