[R] Interpretation of download counts of r packages using cranlogs::cran_downloads

from a real user? Best regards, Robin -- Dr. Robin Haunschild Max Planck Institute for Solid State Research Heisenbergstr. 1 D-70569 Stuttgart (Germany) phone: +49 (0) 711-689-1285 fax: +49 (0) 711-689-1292 email: r.haunsch...@fkf.mpg.de http://www.fkf.mpg.de/ivs Publons: https://publons.com

Re: [R] Color in stripchart

Dear Rasmus, thanks, that works, too. Great! Best, Robin On 3/10/21 5:22 PM, Rasmus Liland wrote: > Hello there again, > > Sorry, I missed that part in the middle > about set.seed. As per [1], you need to > run stripchart again with the add > argument set to TRUE,

Re: [R] Color in stripchart

Dear Gerrit, thanks a lot; it works with beeswarm and pwcol=df$color. Best, Robin On 3/10/21 3:04 PM, Gerrit Eichner wrote: > Dear Robin, > > if you study stripchart's code (graphics:::stripchart) carefully > you will find out that the elements of the vector provided to the &g

Re: [R] Color in stripchart

Dear Rasmus, there is no difference in the small exmaple, because there is only one point per year. If you use the example with multiple points per year, you will see the difference. Best, Robin On 3/10/21 3:15 PM, Rasmus Liland wrote: > Dear Robin and Gerrit, > > I am unab

[R] Color in stripchart

method='stack') points(df[df$color=='blue',]$value, df[df$color=='blue',]$year-2010, type='p', pch=18, col='blue') points(df[df$color=='red',]$value, df[df$color=='red',]$year-2010, type='p', pch=18, col='red') Am I somehow misusing the stripchart function? Best regards, Robin -- Dr. Robin Hauns

Re: [R] AES spesification

Hi, what about this one? ggplot(data=mpg[mpg$year==1999,], aes(x=displ, y=hwy))+ geom_point() Best, Robin On 10/21/20 3:37 PM, Engin Yılmaz wrote: > Dear > > I use dataset , as called "mpg" > > This is code > > ggplot(data=mpg)+ geom_point(mapping =

[R] Different performance with different R versions

I am running a small simulation, and getting very different run times when I use different versions of R. Two set-ups using the same machine (MacBook Pro 2013 vintage) 1. R version 3.1.3 running on system OS X 10.9.5 > system.time(source("simulationR-R.R")) user system elapsed 3.890

Re: [R] Merging dataframes

Name.x),] Table_C contains all data from Table_A and Table_B. The key.x is NA if the row comes from Table_B and key.y is NA if the row comes from Table_A. Best, Robin On 05/02/2018 11:38 AM, Chintanu wrote: > Thanks - Peter, Eivind, Rui > > > Sorry, I perhaps could not expla

[R] Assigning fate percent to plots

Hi. I have a big data set which could be represented something like this: *plot fate* 1 S 2 M 3 S 3 S 3 M 4 S 4 S 5 S 5 M 5 S 5 S 6 M 7 M where plot is a location, and fate is either

[R] gam mgcv family=scat

is theoretically sound (i.e. is it okay to include these different smooth types (ti, s bs=re) with this family)? Any advice would be greatly appreciated. Thanks in advance. Robin [[alternative HTML version deleted]] __ R-help@r-project.org mailing list

Re: [R] Maximum likelihood with analytical Hessian and

* (# parameters)^2 in size) is not worth the effort, but there are problems for which it does make a lot of sense. JN On 14-12-18 06:00 AM, r-help-requ...@r-project.org wrote: Message: 12 Date: Wed, 17 Dec 2014 21:46:16 +0100 From: Xavier Robin ro...@lindinglab.org To: r-help@r-project.org

[R] Maximum likelihood with analytical Hessian and

Dear list, I have an optimization problem that I would like to solve by Maximum Likelihood. I have analytical functions for the first and second derivatives of my parameters. In addition, some parameters are constrained between 0 and 1, while some others can vary freely between -Inf and +Inf. I

[R] ANOVA in R

ID a_t1a_t2b_t1b_t2 CACCCGTAGAACCGACCTTGCG_mmu-miR-99b-5p15781941234810941 CACCCGTAGAACCGACCTTGC_mmu-miR-99b-5p4424265643839 CACCCGTAGAACCGACCTTG_mmu-miR-99b-5p544366253 CCGTAGAACCGACCTTGCG_mmu-miR-99b-5p263333157

[R] R help-classification accuracy of DFA and RF using caret

function to my data. As I am relatively new to R and my thesis committee is unable to help as they are also unf! amiliar with R, I thought it best to ask for help. Would someone be willing to help me? Thanks, Robin http://www.epa.gov/wed/pages/models/rivpacs/rivpacs.htm TrainDataDFAgrps2

[R] correlation between rows of different data frames

Hi, I have two data frames with time serie datamatrix. I want to pick a row X from the first matrix and see if it correlates with row Y in the second matrix. These are gene expression values and I probaly need to do some scaling first, but I wonder if you have any suggestions on how to do the

[R] EdgeR annotation

after updating R and edgeR I lost the annotations in the final Diff.Expressed matrix (toptags) when running the edgeR pipeline. How do I get the row.names from the data matrix into the topTag-matrix? data - read.table(KO_and_WT_Summary_miRNA_Expression.csv, row.names=1, sep=, header=T) keep -

[R] Flexmix and variance of error terms

Hi, I am using flexmix to model some data which is modelled with linear regressions. I have results obtained along the lines of that shown below, and can retreive component parameters, but I cannot find a way or retrieving the variance of the sigma (variance of the normal model) can anyone

Re: [R] How to create a dendrogram with colored branches

Hi, You'll find a usefull post here : http://gastonsanchez.wordpress.com/2012/10/03/7-ways-to-plot-dendrograms-in-r/ For my part, I use the last method (A2R) to plot trees like the figure you posted. HTH, Robin 2013/8/3 beginner pa...@nottingham.ac.uk Hi I would like to create

[R] strings

I have two files containing words. I want to print the are in file 1 but NOT in file 2. How do I go about? file 1: ABL1 1 ALKBH1 2 ALKBH2 3 ALKBH3 4ANKRD17 5 APEX1 6 APEX2 7 APTX 8 ASF1A 9 ASTE1 10 ATM 11 ATR 12 ATRIP 13 ATRX 14

[R] Regression and FMMs with flexmix

I am repeating this because it seems that some people think it is important to reveal your identity I don;t understand why this is so important. Hopefuly now this list will be helpful. Could someone please assist with this I am trying to understand how to use the flexmix package, I have

[R] Overlay two stat_ecdf() plots

I want to plot two scdf-plots in the same graph. I have two input tables with one column each: Targets - read.table(/media/, sep=, header=T) NonTargets - read.table(/media/..., sep=, header=T) head(Targets) V1 1 3.160514 2 6.701948 3 4.093844 4 1.992014 5 1.604751 6 2.076802

[R] gdata selectively not working

xls file “C:/Dropbox/R/library/gdata/xls/ExampleExcelFile.xlsx” to csv file “C:\Users\Robin\AppData\Local\Temp\RtmpWkmGgn\file1bccd743d36.csv” ... Executing ' C:\Perl64\bin\perl.exe C:/Dropbox/R/library/gdata/perl/ xls2csv.pl C:/Dropbox/R/library/gdata/xls/ExampleExcelFile.xlsx C:\Users

Re: [R] gdata selectively not working

into Gdata. If I move it into another location, say C:/Temp then its fine. Annoying, but I will have to work around it for now. -Robin On Tue, Apr 2, 2013 at 4:41 AM, Paul Johnson pauljoh...@gmail.com wrote: On Apr 2, 2013 1:28 AM, Robin Jeffries robin.a.jeffr...@gmail.com wrote: I can use

[R] gls + summary assumptions

Dear R users,I proceeded to a regression through the gls fonction (package nlme) with the following code: a1=read.table(total25.txt,header=TRUE)a1$T=factor(a1$T)m2=gls(Res~ModeF*T,a1)m2summary(m2) I used gls fonction because it deals with heteroskedasticity and I would like you to confirm that I

[R] facet plot

Hi all, I want to plot a facet plot with column names as x and column values as y. One plot for each row. here is part of my dataset: Gene T0h T0.25h T0.5h T1h T2h T3h T6h T12h T24h T48h NM_001001130 68 95 56 43 66 62 68 90 63 89 NM_001001144 0 1 4 0 1 1 1 4 1 2 NM_001001152 79 129 52 50

[R] Change class of elements in list

as a TIFF file, with the name of the elements in the list. This also works for a single object in package rgdal: writeGDAL(b, sp1.TIFF) Many thanks, Robin [[alternative HTML version deleted]] __ R-help

[R] Single node in tree

Hi there, I'm new to R and need some help. I have a dataset of 30,000 records with a response (1/0) indicator resulting in a response rate of 29%. I have 1 categorical predictor variable (gender - M/F) and two continuous variables (score and age). When I create an rpart model, I only get one

[R] Subsetting with missing data

looking.. or I'm reaaly forgetting something important. Thanks, Robin Jeffries MS, DrPH Candidate Department of Biostatistics, UCLA 530-633-STAT(7828) rjeffr...@ucla.edu [[alternative HTML version deleted]] __ R-help@r-project.org mailing

[R] [R-pkgs] new package on CRAN: multivator

Dear list, The new package 'multivator' is now available on CRAN. This presents a multivariate generalization of the emulator package. The corresponding JSS article is: Robin K. S. Hankin (2012), Introducing multivator: A Multivariate Emulator, Journal of Statistical Software, 46(8), 1-20

Re: [R] Executable expressions

Hi eval(parse(text=a)) should do the trick :) Cheers, Robin 2012/1/18 Ajay Askoolum aa2e...@yahoo.co.uk Given a-c(1,2,3,4,5) How can I evaluate the variable a to return a (numeric) vector comprising of 1,2,3,4,5? Thanks. [[alternative HTML version deleted

Re: [R] Improve a browse through list items - Transform a loop to apply-able function.

Thanks to all of you for those answers, it now works and it's way faster than it used to be ;) Especially, converting my list of matrix to a 3-dimensionnal array simplifies a lot the statistics I have to run on my data :) Thanks again, Robin 2011/12/14 Patrizio Frederic frederic.patri

[R] Improve a browse through list items - Transform a loop to apply-able function.

are really long to run, considering that my lists contains like 100 dataframes, who all contains thousands of values. Any help would be really appreciated Thanks in advance, Robin [[alternative HTML version deleted]] __ R-help@r-project.org mailing

[R] Multiple selection, renaming and saving the results

Dear all, I have a big data frame: str(data1) 'data.frame': 18272 obs. of 11 variables: $ tag : int 11 12 13 15 17 18 19 100011 100012 100014 ... $ sp : Factor w/ 18 levels acassp,acocar,..: 13 5 7 14 14 18 3 11 13 10 ... $ gx : num 20 10 35 68 88

[R] attach 'name' argument ignored with a file?

Dear useRs experRts, I have the feeling that the 'name' argument to the attach function is ignored when 'what' is a file name. Here is an example: save(letters, file=letters.RData) letters.env - attach(letters.RData, name=letters) search() letters.env The name on the search path is

[R] Error message after updating pkg spatstat

in R_decompress1 Can anyone help? Thanks greatly, my session info is below. I am running R 2.13.1 on a Mac. Robin sessionInfo() R version 2.13.1 (2011-07-08) Platform: x86_64-apple-darwin9.8.0/x86_64 (64-bit) locale: [1] en_US.UTF-8/en_US.UTF-8/C/C/en_US.UTF-8/en_US.UTF-8 attached base packages: [1

[R] Equivalent of win.print for Linux

Hi! In Windows the win.print function allows plotting directly to a printer (or copying an open device to the printer). This is very convenient to quickly print a plot once it looks good. Is there an equivalent function under Linux? For example through CUPS, IPP, LPD or other ? Obviously with a

Re: [R] Equivalent of win.print for Linux

=blah) Now the question is, is there a printer device equivalent to win.print for Linux? Thanks, Xavier On Fri, Oct 28, 2011 at 15:23, Raphael Saldanha wrote: I have never used, but take a look on ?dev.print On Fri, Oct 28, 2011 at 11:16 AM, Xavier Robin xavier.ro...@unige.chwrote: Hi

Re: [R] Equivalent of win.print for Linux

Thank you, it was exactly what I was looking for! Regards, Xavier Le 28. 10. 11 15:45, Prof Brian Ripley a écrit : See the help for postscript ... especially the 'Printing' section. On Fri, 28 Oct 2011, Xavier Robin wrote: Hi! In Windows the win.print function allows plotting directly

Re: [R] How can I check a package is installed or not?

Hi I'm using this :) if (is.element('DESeq', installed.packages()[,1]) == FALSE) { install.packages('DESeq') } Robin 2011/9/27 Fabrice Tourre fabrice.c...@gmail.com Dear list, How can I detect a package is installed or not? If not, then install it. For example, in a script, I want

[R] Rect.hclust problem - which= not working

how I could, in my script, got my boxes colored in the right order given in my which parameter ? Thanks, Robin Cura PS : A part of my code : par(mfrow=c(1,2), oma=c(2,2,2,2)) plot(hang = 0.2,mydata.cah, main=Arbre des classes, xlab=Classes, ylab=Dissimilarité, sub= , labels=FALSE

[R] Resources for utilizing multiple processors

the pre-and post- processing tidbits! So if anyone has any suggestions as to a direction I can look into, it would be appreciated. Robin Jeffries MS, DrPH Candidate Department of Biostatistics UCLA 530-633-STAT(7828) [[alternative HTML version deleted

[R] [R-pkgs] pROC 1.4.3: compare two ROC curves in R

information in our paper [4] and on pROC website: http://www.expasy.org/tools/pROC/ Hope you'll find it useful! Xavier Robin -- References: [1] DeLong ER, DeLong DM, Clarke-Pearson DL (1988) Comparing the areas under two or more correlated receiver operating characteristic curves: a nonparametric

[R] Help with one of those apply functions

on the right format. Can someone give me a heads up as to what the correct syntax and function is? Danke, Robin Jeffries MS, DrPH Candidate Department of Biostatistics UCLA 530-624-0428 [[alternative HTML version deleted]] __ R-help@r

Re: [R] Help with one of those apply functions

Thanks Steve, I needed the alternative. tapply worked for my toy example, but it didn't for my real example. it might be b/c it was in a data frame, but i'm not sure. Using plyr did work however. Robin Jeffries MS, DrPH Candidate Department of Biostatistics UCLA 530-624-0428 On Wed, Feb 2

Re: [R] Integration of two lines

Hans W Borchers wrote : First define a function from those points: fx - approxfun(x, f_x) fy - approxfun(y, f_y) f - function(x) abs(fx(x)-fy(x)) and now you can apply integrate() or trapz(): xx - sort(c(x, y)) yy - f(xx) trapz(xx, yy) trapz() should

[R] Integration of two lines

Hello, I need to integrate the absolute difference between two lines measured on different points. # For example : x - seq(0, 1, 1/100) f_x - runif(101) + x y - seq(0, 1, 1/23) f_y - runif(24) + (1 - y) plot(x, f_x, type=l) lines(y, f_y) Then I would like to compute Integral( | f_x - f_y |

Re: [R] Integration of two lines

Le 25.01.2011 15:23, Rmh a écrit : g - function(x) abs(f1(x)-f2(x)) now you have one function and you can integrate it. Thank you Rich. Unfortunately I have no f1 and f2 functions, only a set of observed points on two lines - and no idea about the underlying distribution to create a

Re: [R] Printing pretty' vectors in Sweave

Ah! I was always trying collapse with sep and other options. Not by itself. Perfect! And yes, that was my bad example. Robin Jeffries MS, DrPH Candidate Department of Biostatistics UCLA 530-624-0428 On Tue, Jan 18, 2011 at 10:27 PM, Joshua Wiley jwiley.ps...@gmail.comwrote: Hi Robin

[R] Printing pretty' vectors in Sweave

and put My vector is (\Sweave{cat(c, sep=,)}). prints out My vector is (). Suggestions? Robin Jeffries MS, DrPH Candidate Department of Biostatistics UCLA 530-624-0428 [[alternative HTML version deleted]] __ R-help@r-project.org mailing list

Re: [R] Logistic Regression Fitting with EM-Algorithm

problem. Thanks in advance, Best Regards Robin Magder, L. S. Hughes, J. P. Logistic Regression When the Outcome Is Measured with Uncertainty American Journal of Epidemiology, 1997, 146, 195-203 On 01/04/2011 12:36 AM, (Ted Harding) wrote: On 03-Jan-11 14:02:21, Robin Aly wrote: Hi all

[R] Logistic Regression Fitting with EM-Algorithm

Hi all, is there any package which can do an EM algorithm fitting of logistic regression coefficients given only the explanatory variables? I tried to realize this using the Design package, but I didn't find a way. Thanks a lot Kind regards Robin Aly

[R] How is MissInfo calculated? (mitools)

, Robin Jeffries MS, DrPH Candidate Department of Biostatistics UCLA 530-624-0428 [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http

Re: [R] Trouble installing gsl wrapper

of this thread for the next release. Robin On Sat, Oct 30, 2010 at 8:14 AM, Gang Chen gangch...@gmail.com wrote: You nailed it, Prof. Ripley! Thanks a lot... Gang On Sat, Oct 30, 2010 at 2:58 PM, Prof Brian Ripley rip...@stats.ox.ac.uk wrote: On Sat, 30 Oct 2010, Gang Chen wrote: Hi

[R] GC verbose=false still showing report

28.4 531268 28.4 Vcells 429302 3.3 20829406 159.0 55923977 426.7 I'm embedding this in an Sweave/TeX file, so I *really* can't have this printing out. Suggestions other than manually editing the TeX file? Robin Jeffries MS, DrPH Candidate Department of Biostatistics UCLA 530-624-0428

Re: [R] GC verbose=false still showing report

invisible(gc()) worked perfectly. Thanks Jeff. @ Josh: I know how to toggle showing/hiding command echos, but I haven't figured out how to toggle on/off any printed output. On Sat, Oct 9, 2010 at 5:10 PM, Robin Jeffries rjeffr...@ucla.edu wrote: I must be reading the help file for gc

Re: [R] boundary check

-- Robin K. S. Hankin Uncertainty Analyst University of Cambridge 19 Silver Street Cambridge CB3 9EP 01223-764877 __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org

Re: [R] boundary check

pm, Robin Hankin rk...@cam.ac.uk wrote: Hello convex hulls in large numbers of dimensions are hard. For your problem, though, one can tell whether a given point is inside or outside by using linear programming: X - matrix(rnorm(50), 10, 5) x_i - matrix(rnorm(5), 1, 5) isin.chull

[R] Lattice xyplots plots with multiple lines per cell

mean(outcome) ~ gender + gradelevel. However, I can't figure out how I could get both control and intervention lines in the same plot. Any suggestions? What i'm doing now -works-, but just seems to be the long way around. -Robin [[alternative HTML version deleted

[R] simple table/matrix problem

zero bats, and 'z' has 3 bats and so on for each line. The real application would have a matrix of size ~10 by ~1. -- Robin K. S. Hankin Uncertainty Analyst University of Cambridge 19 Silver Street Cambridge CB3 9EP 01223-764877 __ R-help@r

[R] simple apply syntax

) Thanks, Robin [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal

Re: [R] Function to compute the multinomial beta function?

) = Gamma(n1)*Gamma(n2)*Gamma(n3)/Gamma(n1+n2+n3) beta3- function (n1, n2, n3) exp(lgamma(n1)+lgamma(n2)+lgamma(n3)-lgamma(n1+n2+n3)) beta3(5,3,8) [1] 1.850002e-07 -- Robin K. S. Hankin Uncertainty Analyst University of Cambridge 19 Silver Street Cambridge CB3 9EP 01223-764877

Re: [R] Apply a shift which is a function of the array.

Hello Jim you can use ashift() from the same library which does (I think) what you want. HTH, Robin On 07/02/2010 12:05 PM, Jim Hargreaves wrote: Dear List, I have a 2,000x10,000 array of time domain data which when plotted draws a distinct pulse. The matrix is 10,000 pulses

Re: [R] Apply a shift which is a function of the array.

mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Robin K. S. Hankin Uncertainty Analyst University of Cambridge 19 Silver Street Cambridge CB3

[R] table() of a factor

this records the single d in the original 'x' as a c. What I want is: a b c d 3 1 0 1 How to get this from 'x'? (my real application has dozens of levels with complicated names). -- Robin K. S. Hankin Uncertainty Analyst University of Cambridge 19 Silver Street Cambridge CB3 9EP 01223-764877

Re: [R] table() of a factor

thanks everyone. I think the motto should be always specify the levels of a factor when you create it if you possibly can. best wishes Robin On 06/29/2010 12:39 PM, Felix Andrews wrote: Just use factor(), not levels(); you can pass a factor to factor() too. x- factor(c(rep(a,3),b

[R] Counting indexes

any pointers would be helpful. Many thanks! ~~~ -Robin Jeffries Dr.P.H. Candidate in Biostatistics UCLA School of Public Health rjeffr...@ucla.edu 530-624-0428 [[alternative HTML version deleted]] __ R-help@r-project.org mailing

Re: [R] Counting indexes

Awesome! Thanks:) On Tue, May 25, 2010 at 9:40 PM, Erik Iverson er...@ccbr.umn.edu wrote: Robin Jeffries wrote: Hallo! I have a vector of ID's like so, id - c(1,2,2,3,3,3,4,5,5) I would like to create a [start,stop] pair of vectors that index the first and last observation per ID

[R] sparse matrices in lme4

I read somewhere (help list, documentation) that the random effects in lme4 uses sparse matrix technology. I'd like to confirm with others that I can't use a sparse matrix as a fixed effect? I'm getting an Invalid type (S4) error. Thanks. ~~~ -Robin Jeffries Dr.P.H. Candidate

[R] Regression with sparse matricies

of glm, some way that it will recognize a sparse matrix and avoid large matrix inversions? -Robin [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide

[R] Indexing with sparse matrices (SparseM)

not hooked on this package either, it was just the first one I came across via Rseek. Many thanks, -Robin [[alternative HTML version deleted]] __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read

[R] Source.R file from cmd line

arguments to the command line in a system task. Thanks, ~~~ -Robin Jeffries Dr.P.H. Candidate in Biostatistics UCLA School of Public Health rjeffr...@ucla.edu 530-624-0428 [[alternative HTML version deleted]] __ R-help@r

Re: [R] Obvious reason for not looping twice?

on, but then won't continue to loop. -Robin On Sun, Apr 25, 2010 at 4:44 PM, Peter Alspach peter.alsp...@plantandfood.co.nz wrote: Tena koe Robin Do you get an error or warning? It may have something to do with how == treats NA: x - 1:4 x[x == 1] [1] 1 x - c(1:4, NA) x[x == 1] [1

Re: [R] Obvious reason for not looping twice?

Seriously! That easy! I kept thinking that xtab would just give me frequencies of how many times the combination occurred, and not the values themselves. Thanks! -Robin On Mon, Apr 26, 2010 at 7:40 AM, Henrique Dallazuanna www...@gmail.comwrote: Try this; xtabs(y ~ st + vc, data = x

[R] Obvious reason for not looping twice?

))), dimnames=list(unique(svc$st), unique(svc$vc))) for (i in 1:length(unique(svc$st))) { for (j in 1:length(unique(svc$vc))){ lookup.svc[i,j] - svc[svc$st == unique(svc$st)[i] svc$vc == unique(svc$vc)[j], 4] }} Thanks, Robin ~~~ -Robin Jeffries Dr.P.H. Candidate UCLA School

Re: [R] Frequency table

and Environmental Studies Wilfrid Laurier University Waterloo, Ontario [[alternative HTML version deleted]] -- Robin Evans Statistics Department University of Washington www.stat.washington.edu/~rje42 __ R-help@r-project.org mailing list https

[R] Vectorized forms of isTRUE, identical and all.equal?

() with identical() is very slow because it makes so many separate function calls: x = rbinom(1e4, 1, 0.5) system.time(sapply(x, function(x) isTRUE(all.equal(x, 0 system.time(abs(x) .Machine$double.eps^0.5) The latter version is fast, but potentially dangerous. Any suggestions? Thanks, Robin

Re: [R] Vectorized forms of isTRUE, identical and all.equal?

On 7 April 2010 16:12, Steve Lianoglou mailinglist.honey...@gmail.com wrote: Hi, On Wed, Apr 7, 2010 at 5:44 PM, Robin Evans rj...@stat.washington.edu wrote: Dear all, I'm wondering if there exist vectorized forms of 'isTRUE()', 'identical()' and 'all.equal()'.  My problem is that I wish

Re: [R] Vectorized forms of isTRUE, identical and all.equal?

On 7 April 2010 16:27, Steve Lianoglou mailinglist.honey...@gmail.com wrote: On Wed, Apr 7, 2010 at 7:16 PM, Robin Evans rj...@stat.washington.edu wrote: On 7 April 2010 16:12, Steve Lianoglou mailinglist.honey...@gmail.com wrote: Hi, On Wed, Apr 7, 2010 at 5:44 PM, Robin Evans rj

Re: [R] add points to 3D plot using p3d {onion}

) p3d(head(bunny,100),d0=2,theta=3) points(tail(bunny), col='blue') You'd want the call to points() to remember theta=3, and possibly d0=2 as well. Although I can see a hack I'd be very happy to help you offline. best wishes Robin Bradley Christoffersen wrote: Hi, Can anyone guide me

[R] Problems completely reading in a large sized data set

read everything in as character. I'm also not sure about the 's, I had to put them in to get list() to even accept that. Or c(). Any ideas with this? Thanks! -- Robin Jeffries Dr.P.H. Candidate Department of Biostatistics UCLA School of Public Health [[alternative HTML version deleted

[R] (Solved) Problems completely reading in a large sized data set

I'm not quite sure why, but reading in the *sorted* data (imported into Excel, sorted, written to a text file) worked perfectly fine with read.delim(). Thanks to those that replied! -Robin [[alternative HTML version deleted]] __ R-help@r

Re: [R] Generating data from Null Distribution

the Metropolis-Hastings algorithm. HTH Robin Jim Silverton wrote: Hello everyone, Can someone tell me exactly how to generate data from a null distribution for the fisher exact test? I know I have to use the hypergrometric but exactly what commands do I use? Jim [[alternative HTML

Re: [R] expand.grid game

__ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Robin K. S. Hankin Uncertainty Analyst University

Re: [R] expand.grid game

system elapsed 0.160 0.068 0.228 In some ways I think this is close to Hadley's suggestion, though I didn't know how to implement it. Thanks a lot to everybody who participated, I have learned interesting things from a seemingly innocuous question. Best regards, baptiste 2009/12/21 Robin

Re: [R] expand.grid game

) } Or am I missing something?! Ted. On 21-Dec-09 07:57:32, Robin Hankin wrote: Hi library(partitions) jj - blockparts(rep(9,8),17) dim(jj) gives 318648 HTH rksh baptiste auguie wrote: Dear list, In a little numbers game, I've hit a performance snag and I'm not sure how to code

Re: [R] Fishers exact test at 2.2e-16

__ R-help@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/r-help PLEASE do read the posting guide http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Robin K. S. Hankin

Re: [R] how to creat a matrix

http://www.R-project.org/posting-guide.html and provide commented, minimal, self-contained, reproducible code. -- Robin K. S. Hankin Uncertainty Analyst University of Cambridge 19 Silver Street Cambridge CB3 9EP 01223-764877 __ R-help@r

[R] access elements of a named list using a factor

errors: jj$levels(f)[1] Error: attempt to apply non-function do.call($,jj,levels(f)[1]) Error in if (quote) { : argument is not interpretable as logical $(jj,levels(f)[1]) Error in jj$levels(f)[1] : invalid subscript type 'language' -- Robin K. S. Hankin Uncertainty Analyst University

Re: [R] access elements of a named list using a factor

(pigs = 1:10, slugs = 1:3) jj[levels(f)[1]] jj[[levels(f)[1]]] Best, Dimitris Robin Hankin wrote: Hi I have a factor 'f' and a named list 'jj'. I want names(jj) to match up with levels(f). How do I use levels(f) to access elements of jj? f - factor(c(pigs,pigs,slugs)) f [1] pigs pigs

Re: [R] reference on fisher.test()

the discussion in the vignette(fishervig) in the aylmer package helpful. HTH Robin Peter Dalgaard wrote: Peng Yu wrote: On Thu, Oct 15, 2009 at 4:19 PM, RICHARD M. HEIBERGER r...@temple.edu wrote: On Thu, Oct 15, 2009 at 4:56 PM, Peng Yu pengyu...@gmail.com wrote: Can somebody point me a book

Re: [R] S4 tutorial

Peng the Brobdingnag package includes a vignette that gives a step-by-step guide to creating a simple package that uses S4. best wishes Robin Peng Yu wrote: I'm looking for some tutorial on S4. I only find the following one, which is not in English. Can somebody let me know if there is any

[R] sparse vectors

to both) is 3.4 (=3.3+0.1). What's the best R idiom to achieve this? -- Robin K. S. Hankin Uncertainty Analyst University of Cambridge 19 Silver Street Cambridge CB3 9EP 01223-764877 __ R-help@r-project.org mailing list https://stat.ethz.ch/mailman

Re: [R] Must be a better way to collate sequenced data

the trick, providing I can re-merge in order of the transformed time value. That would avoid the costly sort operation in aggregate. Robin Burke Associate Professor School of Computer Science, Telecommunications, and Information Systems DePaul University (currently on leave at University College

[R] Must be a better way to collate sequenced data

; } utime.rcount - aggregate(augdata, augdata[TIME], sum); Robin Burke Associate Professor School of Computer Science, Telecommunications, and Information Systems DePaul University (currently on leave at University College Dublin) http

Re: [R] Goldbach partitions code

Hi interesting blog! not strictly relevant, but there are various number-theoretic functions implemented in the elliptic package which you might find useful. best wishes Robin murali.me...@fortisinvestments.com wrote: Folks, I put up a brief note describing my naive attempts to compute

[R] swich off printed info

to FALSE. How can I switch off this type of message ? I think of something similar to setting warns option to -1 or similar to a function that could handle the message and throw it out ( a sort of try function for non error messages ... ) Thank you in advance for your answer Robin Girard

[R] reshape() problems

are the timeserieses for cell 1 and cell 2. Is there a nice vectorized way to do this? I can't quite make reshape() do what I want. [the real dataset is months, not quarters, has ~2000 cells and ~60 years] -- Robin K. S. Hankin Uncertainty Analyst University of Cambridge 19 Silver Street

[R] pdf() and pch problems

=en_US.UTF-8;LC_PAPER=en_US.UTF-8;LC_NAME=C;LC_ADDRESS=C;LC_TELEPHONE=C;LC_MEASUREMENT=en_US.UTF-8;LC_IDENTIFICATION=C attached base packages: [1] stats graphics grDevices utils datasets methods base q() le112:~/scratch/R-2.8.1% -- Robin K. S. Hankin Uncertainty Analyst

Re: [R] R package tests

I think the OP was asking about test suites that test the software. The R package structure includes a test/ directory which you can use to put tests. For example, in the onion package I check that I have got my signs and multiplication table correctly implemented: stopifnot(Hi*Hj == Hk)

Re: [R] Construct All Possible Strings from 4 Bases (ATCG)

Gundala f - function(n){expand.grid(rep(list(seq_len(4)),n))} HTH Robin Gundala Viswanath wrote: Dear all, Is there an efficient way in R to construct all strings from 4 bases (ATCG). If we want a length L string, there are 4 ^ L possible strings of such. e . g with L = 2 we have AA

  1   2   >