Hi, I�m using big_blast to compare a contig of 2 Mb with the a complete genome of about 5 Mb. When a do the comparison, I receive a error message that couldn�t found the output file. Analizing the files, I see that the complete query file are splited but inserting some end-of-line characters that makes the file looks like this:
>big_blast_file.00001 GCACGGGGGCTCACGCCATGAAGCGCGCGATCTGCGGTGCGGGCACCGCCTGCGC GGCACGCGCGTGACGGACCCCGATCGCGCCGCCTGCCGCGGTGAGCAGCACTAGCCCGG C CATCCCTGGCAGCACCGCGAAGAGCAGATCCATGTTGTTCGCCGTGCGCAGGTAGTCC GC GTAACCGACCCGGAACGACGCCGGTACCGCGTTCGGTGGCGGGCCCGCAGGTGCCGG TGC CGTCACGGCCGGCGGGGTGAGGGCAGGAACGCTCGGCGTGGCCGGTGAAGGGCCGG GTGC CCCGCCTCCACCGGCCGGCGCGCCGGGAGGCGCGACGACCACCGGGACGGGCGGC ACCGG AGGCACCGCGACCGGCACCGGTGCGACCGGCGCAGCGGGAACCGATGGCGCGGA GGCGAC CGGCGGCTGGGCCCGGATCACGATGCTGCGGTTGCTCGGCGCGGTCGGCACCG GGGCGAG ATTGGGTGCGCGCCCGGTGGTTCCGCCGGTGGGCACCCGGCTGACGCCGTTG CCGCCGCC GCCCGCCACGACCGCGGGTGGTGTGATGCGCGCACCCGTGATCGCTGACTC GGGCACGTC GACAGATTGTGCGGAACGACGGGCCGTCCCGGTCTGCTGGTCGTCGCGGT CGTCCGCTGA And into the blast results, the first query sequence is a 60 characters file. If I�m not wrong, that is not the way that the program should work. I don�t know if there is a parameter for ignore this multiple end-of-line characters for blast. Any help would be appreciate. Thanks in advance ---------------------------------------------------------------------------- -- Lic. Ariel F. Amadio Area "Caracterizaci�n Molecular y Mejoramiento de Microorganismos" Instituto de Microbiolog�a y Zoolog�a Agr�cola (IMYZA) Centro de Investigaciones en Ciencias Veterinarias y Agron�micas (CICVyA) Instituto Nacional de Tecnolog�a Agropecuaria (INTA) CC 25 (1712) Castelar Buenos Aires Argentina Tel. 541-4621-3316/1683 int. 115 FAX 541-4481-1316 --- Outgoing mail is certified Virus Free. Checked by AVG anti-virus system (http://www.grisoft.com). Version: 6.0.577 / Virus Database: 366 - Release Date: 03/02/04
