Hi, strange, I try it again: Hello, I would like to detect the lines starting with >.+ and replace all U with T in the following line, but not in the line starting with > Example:
>NeiUe166 1551 bp rna AGAGAUUGAACAUAAGAGUUUGAUCCUGGCUCAGAUUGAACGCUGGCGGCAUGCUUU >Unc31652 1491 bp rna AGGGUUUGAUCAUGGCUCAGGACGAACGCUGGCGGUGCGCCUUAUGCAUGCAAGUCG >Unc31653 1469 bp rna AGGGUUUGAUCAUGGCUCAGAACGAACGCUGGCGGCAUGCUUCAGACAUGCAAGUCG should look like: >NeiUe166 1551 bp rna AGAGATTGAACATAAGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCATGCTTT >Unc31652 1491 bp rna AGGGTTTGATCATGGCTCAGGACGAACGCTGGCGGTGCGCCTTATGCATGCAAGTCG >Unc31653 1469 bp rna AGGGTTTGATCATGGCTCAGAACGAACGCTGGCGGCATGCTTCAGACATGCAAGTCG The search pattern should find the >.. line but make changes only in the next line Another possibility would be to search just in the "second" line for U and replace with T It would be great if someone has an idea. Thanks a lot archaeal The lines with ">" are for example: ">Unc31653 1469 bp rna " Thanks Achim Le dimanche 12 avril 2020 18:06:25 UTC+2, Bruce Van Allen a écrit : > > Hmm. Not seeing the '>.' anywhere. > > Or did you mean the '.' as a regex character? > > > > On 4/12/20 at 8:01 AM, [email protected] <javascript:> (archaeal) > wrote: > > > Hello, > > I would like to detect the lines starting with >.+ and replace all U > with T > > in the following line, but not in the line starting with > > > Example: > > > > >NeiUe166 1551 bp rna > > AGAGAUUGAACAUAAGAGUUUGAUCCUGGCUCAGAUUGAACGCUGGCGGCAUGCUUU > > >Unc31652 1491 bp rna > > AGGGUUUGAUCAUGGCUCAGGACGAACGCUGGCGGUGCGCCUUAUGCAUGCAAGUCG > > >Unc31653 1469 bp rna > > AGGGUUUGAUCAUGGCUCAGAACGAACGCUGGCGGCAUGCUUCAGACAUGCAAGUCG > > > > should look like: > > >NeiUe166 1551 bp rna > > AGAGATTGAACATAAGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCATGCTTT > > >Unc31652 1491 bp rna > > AGGGTTTGATCATGGCTCAGGACGAACGCTGGCGGTGCGCCTTATGCATGCAAGTCG > > >Unc31653 1469 bp rna > > AGGGTTTGATCATGGCTCAGAACGAACGCTGGCGGCATGCTTCAGACATGCAAGTCG > > > > The search pattern should find the >.. line but make changes only in the > > next line > > Another possibility would be to search just in the "second" line for U > and > > replace with T > > > > It would be great if someone has an idea. > > > > Thanks a lot > > archaeal > > > > > -- > > - Bruce > > _bruce__van_allen__santa_cruz__ca_ > > -- This is the BBEdit Talk public discussion group. If you have a feature request or need technical support, please email "[email protected]" rather than posting here. Follow @bbedit on Twitter: <https://twitter.com/bbedit> --- You received this message because you are subscribed to the Google Groups "BBEdit Talk" group. To unsubscribe from this group and stop receiving emails from it, send an email to [email protected]. To view this discussion on the web visit https://groups.google.com/d/msgid/bbedit/60e52732-c4ad-4923-b5a2-81e6822e5d28%40googlegroups.com.
