Hmm. Not seeing the '>.' anywhere. Or did you mean the '.' as a regex character?
On 4/12/20 at 8:01 AM, [email protected] (archaeal) wrote: > Hello, > I would like to detect the lines starting with >.+ and replace all U with T > in the following line, but not in the line starting with > > Example: > > >NeiUe166 1551 bp rna > AGAGAUUGAACAUAAGAGUUUGAUCCUGGCUCAGAUUGAACGCUGGCGGCAUGCUUU > >Unc31652 1491 bp rna > AGGGUUUGAUCAUGGCUCAGGACGAACGCUGGCGGUGCGCCUUAUGCAUGCAAGUCG > >Unc31653 1469 bp rna > AGGGUUUGAUCAUGGCUCAGAACGAACGCUGGCGGCAUGCUUCAGACAUGCAAGUCG > > should look like: > >NeiUe166 1551 bp rna > AGAGATTGAACATAAGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCATGCTTT > >Unc31652 1491 bp rna > AGGGTTTGATCATGGCTCAGGACGAACGCTGGCGGTGCGCCTTATGCATGCAAGTCG > >Unc31653 1469 bp rna > AGGGTTTGATCATGGCTCAGAACGAACGCTGGCGGCATGCTTCAGACATGCAAGTCG > > The search pattern should find the >.. line but make changes only in the > next line > Another possibility would be to search just in the "second" line for U and > replace with T > > It would be great if someone has an idea. > > Thanks a lot > archaeal > > -- - Bruce _bruce__van_allen__santa_cruz__ca_ -- This is the BBEdit Talk public discussion group. If you have a feature request or need technical support, please email "[email protected]" rather than posting here. Follow @bbedit on Twitter: <https://twitter.com/bbedit> --- You received this message because you are subscribed to the Google Groups "BBEdit Talk" group. To unsubscribe from this group and stop receiving emails from it, send an email to [email protected]. To view this discussion on the web visit https://groups.google.com/d/msgid/bbedit/r480Ps-10146i-31D123048D944FBDBD58DDD9AA8799A6%40Forest.local.
