Hmm. Not seeing the '>.' anywhere.

Or did you mean the '.' as a regex character? 



On 4/12/20 at 8:01 AM, [email protected] (archaeal) wrote:

> Hello,
> I would like to detect the lines starting with >.+ and replace all U with T 
> in the following line, but not in the line starting with >
> Example:
> 
> >NeiUe166        1551 bp          rna
> AGAGAUUGAACAUAAGAGUUUGAUCCUGGCUCAGAUUGAACGCUGGCGGCAUGCUUU
> >Unc31652        1491 bp          rna
> AGGGUUUGAUCAUGGCUCAGGACGAACGCUGGCGGUGCGCCUUAUGCAUGCAAGUCG
> >Unc31653        1469 bp          rna
> AGGGUUUGAUCAUGGCUCAGAACGAACGCUGGCGGCAUGCUUCAGACAUGCAAGUCG
> 
> should look like:
> >NeiUe166        1551 bp          rna
> AGAGATTGAACATAAGAGTTTGATCCTGGCTCAGATTGAACGCTGGCGGCATGCTTT
> >Unc31652        1491 bp          rna
> AGGGTTTGATCATGGCTCAGGACGAACGCTGGCGGTGCGCCTTATGCATGCAAGTCG
> >Unc31653        1469 bp          rna
> AGGGTTTGATCATGGCTCAGAACGAACGCTGGCGGCATGCTTCAGACATGCAAGTCG
> 
> The search pattern should find the >.. line but make changes only in the 
> next line
> Another possibility would be to search just in the "second" line for U and 
> replace with T
> 
> It would be great if someone has an idea.
> 
> Thanks a lot
> archaeal
> 
> 
-- 

  - Bruce

_bruce__van_allen__santa_cruz__ca_

-- 
This is the BBEdit Talk public discussion group. If you have a feature request 
or need technical support, please email "[email protected]" rather than 
posting here. Follow @bbedit on Twitter: <https://twitter.com/bbedit>
--- 
You received this message because you are subscribed to the Google Groups 
"BBEdit Talk" group.
To unsubscribe from this group and stop receiving emails from it, send an email 
to [email protected].
To view this discussion on the web visit 
https://groups.google.com/d/msgid/bbedit/r480Ps-10146i-31D123048D944FBDBD58DDD9AA8799A6%40Forest.local.

Reply via email to