Dear Wei,
I think the problem was due to a file system issue. I check the raid and
one of the disk failed, it could be that this created some problem to
the I/O also because during the run of Rsubread there were many other
I/O processes running.
I run again Rsubread and I did not got any error
Thanks for the help
Raf
On 6/2/13 1:22 AM, Wei Shi wrote:
Dear Raf,
As Martin pointed, that line seems to be the concatenation of two records. But
the second record is incomplete (it doesn't have the read identifier). It seems
more likely to be a file system problem rather than Rsubread problem. Could you
please also provide the line before the problematic line? You may also rerun
the alignment on a different disk to see if you will see this problem again.
Hope this helps.
Best wishes,
Wei
On Jun 2, 2013, at 2:35 AM, Martin Morgan wrote:
On 06/01/2013 08:04 AM, rcaloger wrote:
Hi,
I am using the devel version of Bioconductor as part of the development of my
package chimera.
Testing a new function in chimera, that uses Rsubread package, I encountered a
problem in converting a sam file generated by Rsubread in a bam file.
I used the function asBam from Rsamtools and I got the following error:
In doTryCatch(return(expr), name, parentenv, handler) :
Parse error at line 14667325: sequence and quality are inconsistent
I managed to run asBam if I use only the sam file till line 14667324
Instead I get the above error if I use a sam file finishing at line 14667325
The line that create the problem is the following:
HWI-ST169:273:D0YW6ACXX:2:1201:4070:162856 141 * 0 0 * * 0 0
AAAAAAGGGTTGAATTATTTTCACTTGCCCACGTAGTTTATGAATGTGGGAAATAGCTTCAAAGACAGATTAAATGATTTGCCCAAGGCCACAGAAAAGAG
@@@FFFFFHABHHJGGBFIGIFHGIJHGJGJIFBGHDBG9BDAFIIDHIIGCHCHI<GACC@ADHHHE;7?@DEFED>@;ACCC>ABB;AAD<BC>
77 * 0 0 * * 0 0
CATGGATGAGGAGAATGAGGATTTTGCGCCGGCTGCTCAGAAGATACCGTGAATCTAAGAAGATCGATCGCCACATGTATCACAGCCTGTACCTGAAGGGG
@@@DD?BADHF<D<ACG>FFE;BBF@B?@C@F:(?1.=)))883)8=7@(65??EEBDEC37;;>???=BB@<BBCCACBDDCC:?BCBC:@#########
This looks like two separate records have been concatenated; it's really hard
to know whether this is Rsubread or some aspect of the file system or the way
the file has been handled after creation by Rsubread. Picard is one commonly
used tool for validation. Martin
Does anybody has an idea of what is wrong in this line?
There is any way to validate the sam file before running asBam to detect and
filtered out lines that might create problems in the conversion into Bam?
Cheers
Raf
########
sessionInfo()
R version 3.0.0 (2013-04-03)
Platform: x86_64-unknown-linux-gnu (64-bit)
locale:
[1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C
[3] LC_TIME=en_US.UTF-8 LC_COLLATE=en_US.UTF-8
[5] LC_MONETARY=en_US.UTF-8 LC_MESSAGES=en_US.UTF-8
[7] LC_PAPER=C LC_NAME=C
[9] LC_ADDRESS=C LC_TELEPHONE=C
[11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C
attached base packages:
[1] parallel stats graphics grDevices utils datasets methods
[8] base
other attached packages:
[1] Rsamtools_1.13.16 Biostrings_2.29.3 GenomicRanges_1.13.15
[4] XVector_0.1.0 IRanges_1.19.8 BiocGenerics_0.7.2
loaded via a namespace (and not attached):
[1] bitops_1.0-5 stats4_3.0.0 zlibbioc_1.7.0
--
Computational Biology / Fred Hutchinson Cancer Research Center
1100 Fairview Ave. N.
PO Box 19024 Seattle, WA 98109
Location: Arnold Building M1 B861
Phone: (206) 667-2793
______________________________________________________________________
The information in this email is confidential and inte...{{dropped:20}}
_______________________________________________
Bioc-devel@r-project.org mailing list
https://stat.ethz.ch/mailman/listinfo/bioc-devel
