Hello, If using vmatchPattern to find a sequence in another sequence, the resulting end index can be beyond the length of the subject XStringSet. For example:
forwardPrimer <- "TCTTGTGGAAAGGACGAAACACCG" > range(width(reads)) [1] 75 75 primerEnds <- vmatchPattern(forwardPrimer, reads, max.mismatch = 1) > range(unlist(endIndex(primerEnds)) [1] 23 76 This causes problems if using extractAt to obtain the sequences within each read. For example: sequences = extractAt(reads, locations) Error in .normarg_at2(at, x) : some ranges in 'at' are off-limits with respect to their corresponding sequence in 'x' It's rare, but still a problem, nonetheless. > table(unlist(endIndex(primerLocations)) > 75) FALSE TRUE 366225 2 This happens with Biostrings 2.42.0. -------------------------------------- Dario Strbenac University of Sydney Camperdown NSW 2050 Australia _______________________________________________ Bioc-devel@r-project.org mailing list https://stat.ethz.ch/mailman/listinfo/bioc-devel
