Ivan,
Have you tried Biostrings::vmatchPattern?
Patrick
On 7/23/10 7:02 AM, Ivan Gregoretti wrote:
Hello listers,
How do you count how many of your Illumina tags match a particular sequence?
Well, actually, I know at least two ways of doing this but they are
both slow. This is perhaps the fastest one:
library(ShortRead)
# my sequence of interest (in my real case it is several kbs)
mySeq<- 'AGTGAAGAAGCAAAGAGGCCTCTGCAAGTCACTCAAGAAGTCTACGATTTACATAGCTGACATA'
# load my tags keeping only the ones that pass the filter
A<- readAligned("/my/path", "s_5_export.txt.gz", "SolexaExport",
filter=compose(alignDataFilter(expression(filtering=="Y"))))
# keep only the tags that do not contain Ns
A<- clean(A)
# count how many tags match exactly some portion of mySeq
sum_A<- sum(unlist(sapply(sread(A), function(x)grep(x, mySeq))))
This has been running since yesterday and a similar strategy using
srdistance has been running for 4 days. Can anybody suggest a more
time-efficient calculation?
Thank you,
Ivan
Ivan Gregoretti, PhD
National Institute of Diabetes and Digestive and Kidney Diseases
National Institutes of Health
5 Memorial Dr, Building 5, Room 205.
Bethesda, MD 20892. USA.
Phone: 1-301-496-1016 and 1-301-496-1592
Fax: 1-301-496-9878
_______________________________________________
Bioc-sig-sequencing mailing list
[email protected]
https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing
_______________________________________________
Bioc-sig-sequencing mailing list
[email protected]
https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing