Hi, all,
I am trying to use trimLRPatterns to construct a set of reads after trimming
from both ends. After trimming is done to the three prime, some reads are
already down to zero. Then when I tried to trim from the five prime, the
trimming (trimLRPatterns) did not raise any error, however, the following
DNAStringSet construction threw some errors, like the following. Could anybody
help me? Thanks a lot!
-Kunbin
> #after trimming from the five prime, read No. 2 now is zero in length
> seqsART
A DNAStringSet instance of length 7
width seq
[1] 5 NGTCA
[2] 0
[3] 8 NCGGTGCA
[4] 24 NGACGGTTCACCCCTCGTGGGCAA
[5] 49 TATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAAAAAAAAAAA
[6] 36 TATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAA
[7] 49 TATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAACCTAAACCAGGG
> trimCoordsAL<-trimLRPatterns(Lpattern=adapter, subject=seqsART, max.Lmismatch
> = rep(1,46), ranges=T, with.Lindels=TRUE)
> adapter<-DNAString("TTTACACGCGTCTCCCGGGCTTATCTCGTATGCCGTCTTCTGCTTG")
> trimCoordsAL
IRanges of length 7
start end width
[1] 3 5 3
[2] 2 1 0
[3] 2 8 7
[4] 3 24 22
[5] 27 49 23
[6] 27 36 10
[7] 27 49 23
> seqsAL <- DNAStringSet(seqsART, start=start(trimCoordsAL),
> end=end(trimCoordsAL))
Error in solveUserSEW(width(x), start = start, end = end, width = width) :
solving row 2: 'allow.nonnarrowing' is FALSE and the supplied start (2) is >
refwidth + 1
>
______________________________________________________________________
The contents of this electronic message, including any attachments, are
intended only for the use of the individual or entity to which they are
addressed and may contain confidential information. If you are not the intended
recipient, you are hereby notified that any use, dissemination, distribution,
or copying of this message or any attachment is strictly prohibited. If you
have received this transmission in error, please send an e-mail to
[email protected] and delete this message, along with any
attachments, from your computer.
_______________________________________________
Bioc-sig-sequencing mailing list
[email protected]
https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing
