Thanks for the bug report.
At the moment, you will have to patch the result of your 2nd call to
trimLRPatterns:
trimCoordsAL<-trimLRPatterns(Lpattern=adapter, subject=seqsART, .....
# correction
trimCoordsAL[width(trimCoordsAL)==0] <- IRanges(start=1, end=0)
seqsAL <- DNAStringSet(seqsART, start=start(trimCoordsAL), end=end
(trimCoordsAL))
To be clear, especially if others are reading, your "After trimming
is done to the three
prime..." (which I think is correct) conflicts with "#after trimming
from the five prime".
Now, this was essentially a known problem, as follows:
> trimLRPatterns(subject="", Lpattern="A")
Error in solveSubseqSEW(length(x), start, end, width) :
Invalid sequence coordinates.
Please make sure the supplied 'start', 'end' and 'width' arguments
are defining a region that is within the limits of the sequence.
What you experienced will happen even more simply this way:
> r <- trimLRPatterns(subject="", Lpattern="A", ranges=TRUE)
> r
IRanges of length 1
start end width
[1] 2 1 0
> narrow("", start=start(r), end=end(r))
Error in solveUserSEW(x_width, start = start, end = end, width =
width) :
solving row 1: 'allow.nonnarrowing' is FALSE and the supplied
start (2) is > refwidth + 1
On the other hand:
> narrow("", start=1, end=0)
[1] ""
Hopefully more to follow...
On Oct 26, 2010, at 4:51 PM, Kunbin Qu wrote:
Hi, all,
I am trying to use trimLRPatterns to construct a set of reads after
trimming from both ends. After trimming is done to the three prime,
some reads are already down to zero. Then when I tried to trim from
the five prime, the trimming (trimLRPatterns) did not raise any
error, however, the following DNAStringSet construction threw some
errors, like the following. Could anybody help me? Thanks a lot!
-Kunbin
#after trimming from the five prime, read No. 2 now is zero in length
seqsART
A DNAStringSet instance of length 7
width seq
[1] 5 NGTCA
[2] 0
[3] 8 NCGGTGCA
[4] 24 NGACGGTTCACCCCTCGTGGGCAA
[5] 49 TATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAAAAAAAAAAA
[6] 36 TATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAA
[7] 49 TATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAACCTAAACCAGGG
trimCoordsAL<-trimLRPatterns(Lpattern=adapter, subject=seqsART,
max.Lmismatch = rep(1,46), ranges=T, with.Lindels=TRUE)
adapter<-DNAString("TTTACACGCGTCTCCCGGGCTTATCTCGTATGCCGTCTTCTGCTTG")
trimCoordsAL
IRanges of length 7
start end width
[1] 3 5 3
[2] 2 1 0
[3] 2 8 7
[4] 3 24 22
[5] 27 49 23
[6] 27 36 10
[7] 27 49 23
seqsAL <- DNAStringSet(seqsART, start=start(trimCoordsAL), end=end
(trimCoordsAL))
Error in solveUserSEW(width(x), start = start, end = end, width =
width) :
solving row 2: 'allow.nonnarrowing' is FALSE and the supplied
start (2) is > refwidth + 1
______________________________________________________________________
The contents of this electronic message, including any attachments,
are intended only for the use of the individual or entity to which
they are addressed and may contain confidential information. If you
are not the intended recipient, you are hereby notified that any
use, dissemination, distribution, or copying of this message or any
attachment is strictly prohibited. If you have received this
transmission in error, please send an e-mail to
[email protected] and delete this message, along with
any attachments, from your computer.
_______________________________________________
Bioc-sig-sequencing mailing list
[email protected]
https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing
_______________________________________________
Bioc-sig-sequencing mailing list
[email protected]
https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing
