dear harris: thank you very much for your help, but i think your method can only deal with the special case. we need a more general method to remove adaptor and barcode in 3' or 5' position. so i write such coding to remove 3' adaptor+barcode PCR2<- DNAString("CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT") barcode1 <- DNAString("CGATT") PCR2<- append(PCR2,barcode1) PCR2rc<-reverseComplement(PCR2)# clippedCoords <- trimLRPatterns(Rpattern = PCR2rc, subject = sread(trimmedReads), max.Rmismatch=0.2, with.Rindels=T,ranges=T) clippedReads <- narrow(trimmedReads, start=start(clippedCoords), end=end(clippedCoords)) but for adaptor on the 5' end we must find a more general way to recognize them and remove the whole reads??
shan gao [[alternative HTML version deleted]] _______________________________________________ Bioc-sig-sequencing mailing list Bioc-sig-sequencing@r-project.org https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing