I'm sorry, but I can't guess what "my method" was, nor what you are asking now. Also, whether you are saying that something works at one end of a 'subject' but
not the other (so you had to reflect?), and what 'trimmedReads' is.

On Sep 26, 2011, at 10:39 PM, wang peter wrote:

dear harris:
thank you very much for your help, but i think your method can only deal with
the special case.
we need a more general method to remove adaptor and barcode in 3' or 5'
position.
         so i write such coding to remove 3' adaptor+barcode
PCR2<- DNAString ("CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT")
barcode1 <- DNAString("CGATT")
PCR2<- append(PCR2,barcode1)
PCR2rc<-reverseComplement(PCR2)#
clippedCoords <- trimLRPatterns(Rpattern = PCR2rc, subject = sread (trimmedReads), max.Rmismatch=0.2, with.Rindels=T,ranges=T) clippedReads <- narrow(trimmedReads, start=start(clippedCoords), end=end(clippedCoords))
      but for adaptor on the 5' end
we must find a more general way to recognize them and remove the whole reads??

shan gao

_______________________________________________
Bioc-sig-sequencing mailing list
[email protected]
https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing

Reply via email to