I get differend results on differend runs. The hierachy of features
changes (not only the order) - with the same code. I'm using bioJava Live.
I do:
delete(db, "AF100928");
create(db, sequence);
retrieveSeq(db, "AF100928");
and get:
deleting AF100928
adding a sequence
1
retrieving AF100928
AF100928 contains 1 features
Source: ncbi Type: gen contains: 2
Second Level: Source: AIF Type: siRNA contains: 1
Second Level: Source: AIF 5`450 / AIF 3`682 Type: Amplicon contains: 0
OR, on some runs (at least one in 10) I get:
deleting AF100928
adding a sequence
1
retrieving AF100928
AF100928 contains 2 features
Source: 1 Type: AIF-1 contains: 0
Project : [2572/73, A]
Source: ncbi Type: gen contains: 8
Second Level: Source: AIF Type: siRNA contains: 0
Second Level: Source: AIF 5`450 / AIF 3`682 Type: Amplicon contains: 0
Second Level: Source: AIF Type: siRNA contains: 0
Second Level: Source: AIF 5`450 / AIF 3`682 Type: Amplicon contains: 0
Second Level: Source: AIF Type: siRNA contains: 0
Second Level: Source: AIF 5`450 / AIF 3`682 Type: Amplicon contains: 0
Second Level: Source: AIF Type: siRNA contains: 0
Second Level: Source: AIF 5`450 / AIF 3`682 Type: Amplicon contains: 0
Just in case, I attached the source. I can see only 4 features in
Table seqfeature - but that might not be the right table to look into?
Can anybody help me with this?
Thanks
Martina
import org.biojava.bio.BioException;
import org.biojava.bio.symbol.*;
import org.biojava.bio.*;
import org.biojava.bio.seq.*;
import org.biojava.utils.*;
import org.biojava.bio.seq.DNATools;
import org.biojava.bio.seq.Sequence;
import org.biojava.bio.seq.db.biosql.BioSQLSequenceDB;
import org.biojava.utils.ChangeVetoException;
import org.biojava.bio.seq.io.SeqIOTools;
import java.io.*;
import java.sql.SQLException;
import java.util.*;
/**
* <p>
* Tests a connection to a BioSQLSequenceDB and a simple Sequence write, read
* and delete
* </p>
*/
public class bioSqlTest {
public static void main(String[] args) {
// url format depends on your jdbc driver
String dbURL = "jdbc:mysql://somnus/test";
String dbUser = "xxxxxxx";
String dbPass = "xxxxx";
// we will connect to a biodatabase called test
String biodatabase = "test";
// or create one if it doesn't exist
boolean createIfMissing = true;
try {
// load a JDBC driver
Class.forName("com.mysql.jdbc.Driver");
} catch (ClassNotFoundException ex) {
System.out
.println("Cannot find DB driver, is it
on your classpath?");
}
try {
// create a connection
BioSQLSequenceDB db = new BioSQLSequenceDB(dbURL,
dbUser, dbPass,
biodatabase, createIfMissing);
String sequence =
"agaggaaagggaaggaggaggtcccgaatagcggtcgccgaaatgttccggtgtggaggcctggcggcgggtgctttgaagcagaagctggtgcccttggtgcggaccgtgtgcgtccgaagcccgaggcagaggaaccggctcccaggcaacttgttccagcgatggcatgttcctctagaactccagatgacaagacaaatggctagctctggtgcatcagggggcaaaatcgataattctgtgttagtccttattgtgggcttatcaacagtaggagctggtgcctatgcctacaagactatgaaagaggacgaaaaaagatacaatgaaagaatttcagggttagggctgacaccagaacagaaacagaaaaaggccgcgttatctgcttcagaaggagaggaagttcctcaagacaaggcgccaagtcatgttcctttcctgctaattggtggaggcacagctgcttttgctgcagccagatccatccgggctcgggatcctggggccagggtactgattgtatctgaagatcctgagctgccgtacatgcgacctcctctttcaaaagaactgtggttttcagatgacccaaatgtcacaaagacactgcgattcaaacagtggaatggaaaagagagaagcatatatttccagccaccttctttctatgtctctgctcaggacctgcctcatattgagaatggtggtgtggctgtcctcactgggaagaaggtagtacagctggatgtgagagacaacatggtgaaacttaatgatggctctcaaataacctatgaaaagtgcttgattgcaacaggaggtactccaagaagtctgtctgccattgatagggctggagcagaggtgaagagtagaacaacgcttttcagaaagattggagactttagaagcttggagaagatttcacgggaagtcaaatcaattacgattatcggtgggggcttccttggtagcgaactggcctgtgctcttggcagaaaggctcgagccttgggcacagaagtgattcaactcttccccgagaaaggaaatatgggaaagatcctccccgaatacctcagcaactggaccatggaaaaagtcagacgagagggggttaaggtgatgcccaatgctattgtgcaatccgttggagtcagcagtggcaagttacttatcaagctgaaagacggcaggaaggtagaaactgaccacatagtggcagctgtgggcctggagcccaatgttgagttggccaagactggtggcctggaaatagactcagattttggtggcttccgggtaaatgcagagctacaagcacgctctaacatctgggtggcaggagatgctgcatgcttctacgatataaagttgggaaggaggcgggtagagcaccatgatcacgctgttgtgagtggaagattggctggagaaaatatgactggagctgctaagccgtactggcatcagtcaatgttctggagtgatttgggccccgatgttggctatgaagctattggtcttgtggacagtagtttgcccacagttggtgtttttgcaaaagcaactgcacaagacaaccccaaatctgccacagagcagtcaggaactggtatccgatcagagagtgagacagagtccgaggcctcagaaattactattcctcccagcaccccggcagttccacaggctcccgtccagggggaggactacggcaaaggtgtcatcttctacctcagggacaaagtggtcgtggggattgtgctatggaacatctttaaccgaatgccaatagcaaggaagatcattaaggacggtgagcagcatgaagatctcaatgaagtagccaaactattcaacattcatgaagactgaagccccacagtggaattggcaa";
sequence = sequence.replace(" ", "");
delete(db, "AF100928");
create(db, sequence);
retrieveSeq(db, "AF100928");
}
// } catch (ChangeVetoException ex) {
// System.err.println("Cannot add Sequence, is the DB locked?");
// System.exit(1);
//
// }
catch (Exception ex) {
ex.printStackTrace();
System.exit(1);
}
}
private static void create(BioSQLSequenceDB db, String sequence)
throws IllegalSymbolException, IllegalArgumentException,
ChangeVetoException, IndexOutOfBoundsException,
BioException {
Sequence seq = DNATools.createDNASequence(sequence, "AF100928");
// add annotation
seq.getAnnotation().setProperty("Lab-Genname", "AIF");
seq.getAnnotation().setProperty("gi", "4323586");
seq.getAnnotation()
.setProperty("genename", "apoptosis-inducing
factor");
seq.getAnnotation().setProperty("organism", "Homo sapiens");
seq.getAnnotation().setProperty("protein-id", "AAD16436.1");
// fill the template
Feature.Template templSeq = new Feature.Template();
templSeq.source = "ncbi";
// templSeq.strand = StrandedFeature.UNKNOWN;
templSeq.type = "gen";
templSeq.location = Location.empty;
Feature seqF = seq.createFeature(templSeq);
// create siRNA
StrandedFeature.Template templSt = new
StrandedFeature.Template();
templSt.location = new RangeLocation(201, 221);
templSt.strand = StrandedFeature.POSITIVE;
templSt.source = "AIF"; // =>id
templSt.type = "siRNA"; // oder shRNA oder cellline?
Annotation annoSiRNA = new SimpleAnnotation();
annoSiRNA.setProperty("abbreviation", "AIF");
annoSiRNA.setProperty("no", 3);
templSt.annotation = annoSiRNA;
Feature sf = seqF.createFeature(templSt);
// create charge
Feature.Template charge = new Feature.Template();
charge.type = "AIF-1"; // Name, so wie er in der siRNA Liste
steht
charge.source = "1"; // Erste Synthese
charge.location = Location.empty;
Annotation chargeAnno = new SmallAnnotation();
chargeAnno.setProperty("Batchno", "2572/73");
chargeAnno.setProperty("Project", "A");
charge.annotation = chargeAnno;
Feature cf = sf.createFeature(charge);
// create Amplicon
StrandedFeature.Template templ = new StrandedFeature.Template();
templ.location = new RangeLocation(72, 92);
templ.source = "AIF 5`450 / AIF 3`682";
templ.type = "Amplicon";
templ.strand = StrandedFeature.UNKNOWN;
Annotation annoAmplicon = new SimpleAnnotation();
annoAmplicon.setProperty("Provider", "Invitrogen");
annoAmplicon.setProperty("designed by", "Chris");
annoAmplicon.setProperty("Stock-Box/Position", "rtS-A3/A5 +
rtS-A3/A6");
annoAmplicon.setProperty("Arbeitslösung", "rtArb-A1/C3");
// templ.annotation = annoAmplicon;
Feature af = seqF.createFeature(templ);
System.out.println("adding a sequence");
System.out.println(seq.countFeatures());
db.addSequence(seq);
// seq = null; //cannot remove unless there are no references
to the
// sequence
}
private static void delete(BioSQLSequenceDB db, String name) {
try {
// delete the record
System.out.println("deleting " + name);
db.removeSequence(name);
} catch (Exception ex) {
System.err.println("Cannot remove " + name + " is the
DB locked?");
}
}
private static void retrieveSeq(BioSQLSequenceDB db, String seqName)
throws BioException, NoSuchElementException {
Sequence seq;
System.out.println("retrieving " + seqName);
seq = db.getSequence(seqName);
// try {
System.out.println(seq.getName() + " contains " +
seq.countFeatures()
+ " features");
for (Iterator<Feature> i = seq.features(); i.hasNext();) {
Feature f = (Feature) i.next();
/* Print only 'toplevel' features */
System.out.println("Source: " + f.getSource() + " Type:
"
+ f.getType() + " contains: " +
f.countFeatures());
Annotation anno = f.getAnnotation();
// print each key value pair
for (Iterator it = anno.keys().iterator();
it.hasNext();) {
Object key = it.next();
System.out.println(key + " : " +
anno.getProperty(key));
}
for (Iterator<Feature> it = f.features();
it.hasNext();) {
Feature fs = (Feature) it.next();
// print second level features
System.out.println("Second Level: Source: " +
fs.getSource()
+ " Type: " + fs.getType() + "
contains: "
+ fs.countFeatures());
}
}
}
}
_______________________________________________
Biojava-l mailing list - Biojava-l@biojava.org
http://biojava.org/mailman/listinfo/biojava-l