The problem with changing the method names is backward compatability.
We can introduce some new method names, but the old ones will have to remain around for a while so as to not break already generated code and projects that intergrate Castor. It's very difficult to change the API of a class that is used frequently such as the Marshaller and Unmarshaller without causing problems to most of the people using them. --Keith Heiko Erhardt wrote: > > > Renaming the methods is definitely not on the to-do list right now but > > as you said many users fall into this pitfall. I would remind that the > > user is responsible to check the documentation of an API before/while > > using it. > > Sure he is. However, choosing the same for static and object-related > methods leads to confusion easily. Well, this is also some kind of > Java issue. I can't consider it a good design making static methods > accessible by using an instance object instead of the class name. :( > Java also has its disadvantages... > > Heiko Erhardt > skynamics AG > www.skynamics.com > > > -----Original Message----- > > From: Arnaud Blandin [mailto:[EMAIL PROTECTED]] > > Sent: Friday, June 07, 2002 2:08 PM > > To: [EMAIL PROTECTED] > > Subject: Re: [castor-dev] help: unable to find FieldDescriptor for... > > > > > > Hi Heiko, > > > > Renaming the methods is definitely not on the to-do list right now but > > as you said many users fall into this pitfall. I would remind that the > > user is responsible to check the documentation of an API before/while > > using it. > > Anyway we'll try to think about a solution. > > > > Arnaud > > > > > -----Original Message----- > > > From: Heiko Erhardt [mailto:[EMAIL PROTECTED]] > > > Sent: Friday, June 07, 2002 12:08 PM > > > To: [EMAIL PROTECTED] > > > Subject: Re: [castor-dev] help: unable to find FieldDescriptor for... > > > > > > > dnas = (DASDNA)unmar.unmarshal(DASDNA.class, inReader); > > > wasn't working because you invoked the static unmarshal method, > > > which won't consider any mapping files you added to unmar by calling > > > unmar.setMapping. This approach will use the default 'magic' in > > > Castor's mapping framework, which is based upon introspection of > > > the classes. > > > This seems to be a common cause of trouble, many people stumbled > > > into this pitfall (so did I ;) > > > Keith, what do you think about renaming the static unmarshal method > > > to something like unmarshalDefault to prevent this confusion? > > > > > > Reading the mapping from a location different from the class file's > > > shouldn't be a problem. > > > > > > Mapping mapping = new Mapping (getClass ().getClassLoader ()); > > > URL url = new URL ("file:/..."); > > > mapping.loadMapping (url); > > > unmar.setMapping (mapping); > > > > > > will load the mapping from the specified url. See the java.net.URL > > class for > > > details. > > > > > > HTH, > > > > > > Heiko Erhardt > > > skynamics AG > > > www.skynamics.com > > > > > > > -----Original Message----- > > > > From: michael.l.stoppelman.1 [mailto:[EMAIL PROTECTED]] > > > > Sent: Friday, June 07, 2002 5:44 AM > > > > To: [EMAIL PROTECTED] > > > > Subject: Re: [castor-dev] help: unable to find FieldDescriptor > > for... > > > > > > > > > > > > That might be another problem, but I got it to work with that > > mapping... > > > > The problem was that the class files for the xml parser needed to be > > in > > > > the same directory as the class that made the mapping... It wasn't > > working > > > > because of this line: > > > > > > > > dnas = (DASDNA)unmar.unmarshal(DASDNA.class, inReader); > > > > > > > > That line was causing the error, when you remove the DASDNA.class > > > > > > > > dnas = (DASDNA)unmar.unmarshal(inReader); > > > > > > > > Magic. it works. Anyways, is there a way to tell the xml sax parser > > where > > > > you other class files are so I can have the mapper in a different > > > > directory than my classes that are used for the mapping. > > > > > > > > Thanks again! > > > > Mike > > > > > > > > On Thu, 6 Jun 2002, Keith Visco wrote: > > > > > > > > > > > > > > Your mapping file is incorrect...tracing through the mapping you > > can see > > > > > the problem. > > > > > > > > > > The root element <DASDNA> will most likely get mapped to the > > DASDNA > > > > > class. The first child of <DASDNA> is a <SEQUENCE> element. > > However your > > > > > mapping for DASDNA class only contains one field, which is also > > mapped > > > > > to an element name of <DASDNA>. So there is no <SEQUENCE> binding > > inside > > > > > class DASDNA. > > > > > > > > > > The following change should work: > > > > > > > > > > <class name="edu.mit.wi.omnigene.omnidas.DASDNA"> > > > > > <field name="DNAs" type="edu.mit.wi.omnigene.omnidas.DNA" > > > > > collection="vector"> > > > > > <bind-xml name="SEQUENCE"/> > > > > > </field> > > > > > </class> > > > > > > > > > > notice the bind-xml name has been changed from DASDNA to SEQUENCE. > > > > > > > > > > --Keith > > > > > > > > > > > > > > > > > > > > "michael.l.stoppelman.1" wrote: > > > > > > > > > > > > I am trying to convert xml to an object and I have run into a > > problem, > > > > > > this is with the castor.properties debug set to true: > > > > > > > > > > > > unable to find FieldDescriptor for 'SEQUENCE' in ClassDescriptor > > of > > > DASDNA > > > > > > Ignoring DNA no descriptor was found > > > > > > Ignoring SEQUENCE no descriptor was found > > > > > > > > > > > > My mapping is the following: > > > > > > > > > > > > <?xml version="1.0"?> > > > > > > <!DOCTYPE mapping PUBLIC "-//EXOLAB/Castor Mapping DTD Version > > 1.0//EN" > > > > > > "http://castor.exolab.org/mapping.dtd";> > > > > > > <mapping> > > > > > > <class name="edu.mit.wi.omnigene.omnidas.DASDNA"> > > > > > > > > > > > > <field name="DNAs" > > type="edu.mit.wi.omnigene.omnidas.DNA" > > > > > > collection="vector"> > > > > > > <bind-xml name="DASDNA"/> > > > > > > </field> > > > > > > > > > > > > </class> > > > > > > > > > > > > <class name="edu.mit.wi.omnigene.omnidas.DNA"> > > > > > > <map-to xml="SEQUENCE"/> > > > > > > > > > > > > <!--<field name="Range" > > > > > > type="edu.mit.wi.omnigene.omnidas.RangeImpl"> > > > > > > </field> --> > > > > > > > > > > > > <field name="ID" type="java.lang.String"> > > > > > > <bind-xml name="id" node="attribute"/> > > > > > > </field> > > > > > > > > > > > > <field name="Length" type="long"> > > > > > > <bind-xml name="length" node="attribute"/> > > > > > > </field> > > > > > > > > > > > > <field name="SequenceValue" type="java.lang.String" > > > > > > > <bind-xml name="DNA" node="element"/> > > > > > > </field> > > > > > > </class> > > > > > > > > > > > > <!-- > > > > > > <class name="edu.mit.wi.omnigene.omnidas.RangeImpl" > > > > > > auto-complete="true"> > > > > > > <map-to xml="SEQUENCE" /> > > > > > > <field name="StartPosition" type="long"> > > > > > > <bind-xml name="start" node="attribute"/> > > > > > > </field> > > > > > > > > > > > > <field name="EndPosition" type="long"> > > > > > > <bind-xml name="stop" node="attribute"/> > > > > > > </field> > > > > > > </class> > > > > > > --> > > > > > > > > > > > > </mapping> > > > > > > > > > > > > XML FILE: > > > > > > <?xml version="1.0" standalone="no"?> > > > > > > <!DOCTYPE DASDNA SYSTEM > > "http://www.biodas.org/dtd/dasdna.dtd";> > > > > > > <DASDNA> > > > > > > <SEQUENCE id="1" start="1" stop="100" version="1.00"> > > > > > > <DNA length="100"> > > > > > > > > atttcttggcgtaaataagagtctcaatgagactctcagaagaaaattgataaatattat > > > > > > > > taatgatataataataatcttgttgatccgttctatctccagacgattttcctagtctcc > > > > > > > > agtcgattttgcgctgaaaatgggatatttaatggaattgtttttgtttttattaataaa > > > > > > > > taggaataaatttacgaaaatcacaaaattttcaataaaaaacaccaaaaaaaagagaaa > > > > > > > > aaatgagaaaaatcgacgaaaatcggtataaaatcaaataaaaatagaaggaaaatattc > > > > > > > > agctcgtaaacccacacgtgcggcacggtttcgtgggcggggcgtctctgccgggaaaat > > > > > > > > tttgcgtttaaaaactcacatataggcatccaatggattttcggattttaaaaattaata > > > > > > > > taaaatcagggaaatttttttaaattttttcacatcgatattcggtatcaggggcaaaat > > > > > > > > tagagtcagaaacatatatttccccacaaactctactccccctttaaacaaagcaaagag > > > > > > > > cgatactcattgcctgtagcctctatattatgccttatgggaatgcatttgattgtttcc > > > > > > > > gcatattgtttacaaccatttatacaacatgtgacgtagacgcactgggcggttgtaaaa > > > > > > > > cctgacagaaagaattggtcccgtcatctactttctgattttttggaaaatatgtacaat > > > > > > > > gtcgtccagtattctattccttctcggcgatttggccaagttattcaaacacgtataaat > > > > > > > > aaaaatcaataaagctaggaaaatattttcagccatcacaaagtttcgtcagccttgtta > > > > > > > > tgtcaaccactttttatacaaattatataaccagaaatactattaaataagtatttgtat > > > > > > > > gaaacaatgaacactattataacattttcagaaaatgtagtatttaagcgaaggtagtgc > > > > > > acatcaaggccgtcaaacggaaaaatttttgcaagaatca > > > > > > </DNA> > > > > > > </SEQUENCE> > > > > > > </DASDNA> > > > > > > > > > > > > I have been working at this for about two days :). Any ideas > > would > > > > > > possibly help save my sanity. > > > > > > > > > > > > Thanks in advance, > > > > > > Mike > > > > > > > > > > > > ----------------------------------------------------------- > > > > > > If you wish to unsubscribe from this mailing, send mail to > > > > > > [EMAIL PROTECTED] with a subject of: > > > > > > unsubscribe castor-dev > > > > > > > > > > ----------------------------------------------------------- > > > > > If you wish to unsubscribe from this mailing, send mail to > > > > > [EMAIL PROTECTED] with a subject of: > > > > > unsubscribe castor-dev > > > > > > > > > > > > > > > > > > ----------------------------------------------------------- > > > > If you wish to unsubscribe from this mailing, send mail to > > > > [EMAIL PROTECTED] with a subject of: > > > > unsubscribe castor-dev > > > > > > > > > > ----------------------------------------------------------- > > > If you wish to unsubscribe from this mailing, send mail to > > > [EMAIL PROTECTED] with a subject of: > > > unsubscribe castor-dev > > > > ----------------------------------------------------------- > > If you wish to unsubscribe from this mailing, send mail to > > [EMAIL PROTECTED] with a subject of: > > unsubscribe castor-dev > > > > ----------------------------------------------------------- > If you wish to unsubscribe from this mailing, send mail to > [EMAIL PROTECTED] with a subject of: > unsubscribe castor-dev ----------------------------------------------------------- If you wish to unsubscribe from this mailing, send mail to [EMAIL PROTECTED] with a subject of: unsubscribe castor-dev
