Author: tille Date: 2014-01-18 13:31:45 +0000 (Sat, 18 Jan 2014) New Revision: 15810
Removed: trunk/packages/mira/trunk/debian/patches/make.patch trunk/packages/mira/trunk/debian/patches/spelling.patch Modified: trunk/packages/mira/trunk/debian/changelog trunk/packages/mira/trunk/debian/control trunk/packages/mira/trunk/debian/patches/series Log: Adapted to upstream 4.0rc5 (patches are applied upstream) Modified: trunk/packages/mira/trunk/debian/changelog =================================================================== --- trunk/packages/mira/trunk/debian/changelog 2014-01-18 13:22:39 UTC (rev 15809) +++ trunk/packages/mira/trunk/debian/changelog 2014-01-18 13:31:45 UTC (rev 15810) @@ -1,10 +1,14 @@ -mira (4.0~rc1-1) UNRELEASED; urgency=low +mira (4.0~rc5-1) UNRELEASED; urgency=low - * TODO wait for rc2 and boost transition! + [ Thorsten Alteholz ] * New upstream version - -- Thorsten Alteholz <[email protected]> Tue, 17 Sep 2013 18:00:00 +0200 + [ Andreas Tille ] + * cme fix dpkg-control + * debian/patches/{make.patch,spelling.patch}: applied upstream (thus removed) + -- Andreas Tille <[email protected]> Sat, 18 Jan 2014 13:51:35 +0100 + mira (3.9.18-1) unstable; urgency=low * New upstream version (most patches applied by upstream) Modified: trunk/packages/mira/trunk/debian/control =================================================================== --- trunk/packages/mira/trunk/debian/control 2014-01-18 13:22:39 UTC (rev 15809) +++ trunk/packages/mira/trunk/debian/control 2014-01-18 13:31:45 UTC (rev 15810) @@ -20,7 +20,7 @@ flex, vim-common, zlib1g-dev -Standards-Version: 3.9.4 +Standards-Version: 3.9.5 Vcs-Browser: http://anonscm.debian.org/viewvc/debian-med/trunk/packages/mira/trunk/ Vcs-Svn: svn://anonscm.debian.org/debian-med/trunk/packages/mira/trunk/ Homepage: http://chevreux.org/projects_mira.html @@ -92,4 +92,3 @@ repeats. . This package contains an HTML book introducing to mira. - Deleted: trunk/packages/mira/trunk/debian/patches/make.patch =================================================================== --- trunk/packages/mira/trunk/debian/patches/make.patch 2014-01-18 13:22:39 UTC (rev 15809) +++ trunk/packages/mira/trunk/debian/patches/make.patch 2014-01-18 13:31:45 UTC (rev 15810) @@ -1,26 +0,0 @@ -Index: mira-4.0rc1/src/progs/Makefile.am -=================================================================== ---- mira-4.0rc1.orig/src/progs/Makefile.am 2013-08-17 16:11:50.000000000 +0200 -+++ mira-4.0rc1/src/progs/Makefile.am 2013-09-17 14:41:44.000000000 +0200 -@@ -49,7 +49,7 @@ - rm -f miramem$(EXEEXT) && \ - $(LN_S) mira$(EXEEXT) miramem$(EXEEXT) && \ - rm -f mirabait$(EXEEXT) && \ -- $(LN_S) mira$(EXEEXT) mirabait$(EXEEXT)\ -+ $(LN_S) mira$(EXEEXT) mirabait$(EXEEXT) && \ - rm -f miraconvert$(EXEEXT) && \ - $(LN_S) mira$(EXEEXT) miraconvert$(EXEEXT) - -Index: mira-4.0rc1/src/progs/Makefile.in -=================================================================== ---- mira-4.0rc1.orig/src/progs/Makefile.in 2013-08-17 16:13:05.000000000 +0200 -+++ mira-4.0rc1/src/progs/Makefile.in 2013-09-17 15:06:06.000000000 +0200 -@@ -609,7 +609,7 @@ - rm -f miramem$(EXEEXT) && \ - $(LN_S) mira$(EXEEXT) miramem$(EXEEXT) && \ - rm -f mirabait$(EXEEXT) && \ -- $(LN_S) mira$(EXEEXT) mirabait$(EXEEXT)\ -+ $(LN_S) mira$(EXEEXT) mirabait$(EXEEXT) && \ - rm -f miraconvert$(EXEEXT) && \ - $(LN_S) mira$(EXEEXT) miraconvert$(EXEEXT) - Modified: trunk/packages/mira/trunk/debian/patches/series =================================================================== --- trunk/packages/mira/trunk/debian/patches/series 2014-01-18 13:22:39 UTC (rev 15809) +++ trunk/packages/mira/trunk/debian/patches/series 2014-01-18 13:31:45 UTC (rev 15810) @@ -1,3 +1 @@ #boost-minimal.patch -make.patch -spelling.patch Deleted: trunk/packages/mira/trunk/debian/patches/spelling.patch =================================================================== --- trunk/packages/mira/trunk/debian/patches/spelling.patch 2014-01-18 13:22:39 UTC (rev 15809) +++ trunk/packages/mira/trunk/debian/patches/spelling.patch 2014-01-18 13:31:45 UTC (rev 15810) @@ -1,26 +0,0 @@ -Index: mira-4.0rc1/src/io/gap4_ft_so_map.xxd -=================================================================== ---- mira-4.0rc1.orig/src/io/gap4_ft_so_map.xxd 2013-08-17 16:11:50.000000000 +0200 -+++ mira-4.0rc1/src/io/gap4_ft_so_map.xxd 2013-09-17 15:43:44.000000000 +0200 -@@ -37,7 +37,7 @@ - Fcon conflict sequence_conflict SO:0001085 independent determinations of the "same" sequence differ at this site or region; Or /compare=[accession-number.sequence-version] Different sources report differing sequences. [EBIBS:GAR, UniProt:curation_manual] - Fenh enhancer enhancer SO:0000165 a cis-acting sequence that increases the utilization of (some) eukaryotic promoters, and can function in either orientation and in any location (upstream or downstream) relative to the promoter; A cis-acting sequence that increases the utilization of (some) eukaryotic promoters, and can function in either orientation and in any location (upstream or downstream) relative to the promoter. - Fexn exon exon SO:0000147 region of genome that codes for portion of spliced mRNA, rRNA and tRNA; may contain 5'UTR, all CDSs and 3' UTR; A region of the genome that codes for portion of spliced messenger RNA (SO:0000234); may contain 5'-untranslated region (SO:0000204), all open reading frames (SO:0000236) and 3'-untranslated region (SO:0000205). --Fgap gap gap SO:0000730 gap in the sequence A gap in the sequence of known length. THe unkown bases are filled in with N's. -+Fgap gap gap SO:0000730 gap in the sequence A gap in the sequence of known length. THe unknown bases are filled in with N's. - Fgen gene gene SO:0000704 region of biological interest identified as a gene and for which a name has been assigned; A locatable region of genomic sequence, corresponding to a unit of inheritance, which is associated with regulatory regions, transcribed regions and/or other functional sequence regions - FiDN iDNA iDNA SO:0000723 intervening DNA; DNA which is eliminated through any of several kinds of recombination; Genomic sequence removed from the genome, as a normal event, by a process of recombination. - Fint intron intron SO:0000188 a segment of DNA that is transcribed, but removed from within the transcript by splicing together the sequences (exons) on either side of it; A segment of DNA that is transcribed, but removed from within the transcript by splicing together the sequences (exons) on either side of it. -Index: mira-4.0rc1/src/mira/adaptorsforclip.454.xxd -=================================================================== ---- mira-4.0rc1.orig/src/mira/adaptorsforclip.454.xxd 2013-08-17 16:11:50.000000000 +0200 -+++ mira-4.0rc1/src/mira/adaptorsforclip.454.xxd 2013-09-17 15:44:15.000000000 +0200 -@@ -9,7 +9,7 @@ - # sequences must be included extra in this file (see "rev_*" - # down below - # -->unkown_lookslike_adaptorB -+>unknown_lookslike_adaptorB - ACTCGTATAGTGACACGCAACAGGGGATAGACAAGGCACACAGGGGATA - >unknown_from_cDNA_project_titanium450bp - TTCGCAGTGAGTGACAGGCCACTGAGACTGCCAAGGCACACGAGGGGATAGG _______________________________________________ debian-med-commit mailing list [email protected] http://lists.alioth.debian.org/cgi-bin/mailman/listinfo/debian-med-commit
