Author: tille
Date: 2014-01-18 13:31:45 +0000 (Sat, 18 Jan 2014)
New Revision: 15810

Removed:
   trunk/packages/mira/trunk/debian/patches/make.patch
   trunk/packages/mira/trunk/debian/patches/spelling.patch
Modified:
   trunk/packages/mira/trunk/debian/changelog
   trunk/packages/mira/trunk/debian/control
   trunk/packages/mira/trunk/debian/patches/series
Log:
Adapted to upstream 4.0rc5 (patches are applied upstream)


Modified: trunk/packages/mira/trunk/debian/changelog
===================================================================
--- trunk/packages/mira/trunk/debian/changelog  2014-01-18 13:22:39 UTC (rev 
15809)
+++ trunk/packages/mira/trunk/debian/changelog  2014-01-18 13:31:45 UTC (rev 
15810)
@@ -1,10 +1,14 @@
-mira (4.0~rc1-1) UNRELEASED; urgency=low
+mira (4.0~rc5-1) UNRELEASED; urgency=low
 
-  * TODO wait for rc2 and boost transition!
+  [ Thorsten Alteholz ]
   * New upstream version 
 
- -- Thorsten Alteholz <[email protected]>  Tue, 17 Sep 2013 18:00:00 +0200
+  [ Andreas Tille ]
+  * cme fix dpkg-control
+  * debian/patches/{make.patch,spelling.patch}: applied upstream (thus removed)
 
+ -- Andreas Tille <[email protected]>  Sat, 18 Jan 2014 13:51:35 +0100
+
 mira (3.9.18-1) unstable; urgency=low
 
   * New upstream version (most patches applied by upstream)

Modified: trunk/packages/mira/trunk/debian/control
===================================================================
--- trunk/packages/mira/trunk/debian/control    2014-01-18 13:22:39 UTC (rev 
15809)
+++ trunk/packages/mira/trunk/debian/control    2014-01-18 13:31:45 UTC (rev 
15810)
@@ -20,7 +20,7 @@
                flex,
                vim-common,
                zlib1g-dev
-Standards-Version: 3.9.4
+Standards-Version: 3.9.5
 Vcs-Browser: 
http://anonscm.debian.org/viewvc/debian-med/trunk/packages/mira/trunk/
 Vcs-Svn: svn://anonscm.debian.org/debian-med/trunk/packages/mira/trunk/
 Homepage: http://chevreux.org/projects_mira.html
@@ -92,4 +92,3 @@
  repeats.
  .
  This package contains an HTML book introducing to mira.
-

Deleted: trunk/packages/mira/trunk/debian/patches/make.patch
===================================================================
--- trunk/packages/mira/trunk/debian/patches/make.patch 2014-01-18 13:22:39 UTC 
(rev 15809)
+++ trunk/packages/mira/trunk/debian/patches/make.patch 2014-01-18 13:31:45 UTC 
(rev 15810)
@@ -1,26 +0,0 @@
-Index: mira-4.0rc1/src/progs/Makefile.am
-===================================================================
---- mira-4.0rc1.orig/src/progs/Makefile.am     2013-08-17 16:11:50.000000000 
+0200
-+++ mira-4.0rc1/src/progs/Makefile.am  2013-09-17 14:41:44.000000000 +0200
-@@ -49,7 +49,7 @@
-       rm -f miramem$(EXEEXT) && \
-       $(LN_S) mira$(EXEEXT) miramem$(EXEEXT) && \
-       rm -f mirabait$(EXEEXT) && \
--      $(LN_S) mira$(EXEEXT) mirabait$(EXEEXT)\
-+      $(LN_S) mira$(EXEEXT) mirabait$(EXEEXT) && \
-       rm -f miraconvert$(EXEEXT) && \
-       $(LN_S) mira$(EXEEXT) miraconvert$(EXEEXT)
- 
-Index: mira-4.0rc1/src/progs/Makefile.in
-===================================================================
---- mira-4.0rc1.orig/src/progs/Makefile.in     2013-08-17 16:13:05.000000000 
+0200
-+++ mira-4.0rc1/src/progs/Makefile.in  2013-09-17 15:06:06.000000000 +0200
-@@ -609,7 +609,7 @@
-       rm -f miramem$(EXEEXT) && \
-       $(LN_S) mira$(EXEEXT) miramem$(EXEEXT) && \
-       rm -f mirabait$(EXEEXT) && \
--      $(LN_S) mira$(EXEEXT) mirabait$(EXEEXT)\
-+      $(LN_S) mira$(EXEEXT) mirabait$(EXEEXT) && \
-       rm -f miraconvert$(EXEEXT) && \
-       $(LN_S) mira$(EXEEXT) miraconvert$(EXEEXT)
- 

Modified: trunk/packages/mira/trunk/debian/patches/series
===================================================================
--- trunk/packages/mira/trunk/debian/patches/series     2014-01-18 13:22:39 UTC 
(rev 15809)
+++ trunk/packages/mira/trunk/debian/patches/series     2014-01-18 13:31:45 UTC 
(rev 15810)
@@ -1,3 +1 @@
 #boost-minimal.patch
-make.patch
-spelling.patch

Deleted: trunk/packages/mira/trunk/debian/patches/spelling.patch
===================================================================
--- trunk/packages/mira/trunk/debian/patches/spelling.patch     2014-01-18 
13:22:39 UTC (rev 15809)
+++ trunk/packages/mira/trunk/debian/patches/spelling.patch     2014-01-18 
13:31:45 UTC (rev 15810)
@@ -1,26 +0,0 @@
-Index: mira-4.0rc1/src/io/gap4_ft_so_map.xxd
-===================================================================
---- mira-4.0rc1.orig/src/io/gap4_ft_so_map.xxd 2013-08-17 16:11:50.000000000 
+0200
-+++ mira-4.0rc1/src/io/gap4_ft_so_map.xxd      2013-09-17 15:43:44.000000000 
+0200
-@@ -37,7 +37,7 @@
- Fcon  conflict        sequence_conflict       SO:0001085      independent 
determinations of the "same" sequence differ at this site or region; Or 
/compare=[accession-number.sequence-version]        Different sources report 
differing sequences. [EBIBS:GAR, UniProt:curation_manual]
- Fenh  enhancer        enhancer        SO:0000165      a cis-acting sequence 
that increases the utilization of (some)  eukaryotic promoters, and can 
function in either orientation and in any location (upstream or downstream) 
relative to the promoter;     A cis-acting sequence that increases the 
utilization of (some) eukaryotic promoters, and can function in either 
orientation and in any location (upstream or downstream) relative to the 
promoter.
- Fexn  exon    exon    SO:0000147      region of genome that codes for portion 
of spliced mRNA,  rRNA and tRNA; may contain 5'UTR, all CDSs and 3' UTR;        
A region of the genome that codes for portion of spliced messenger RNA 
(SO:0000234); may contain 5'-untranslated region (SO:0000204), all open reading 
frames (SO:0000236) and 3'-untranslated region (SO:0000205).
--Fgap  gap     gap     SO:0000730      gap in the sequence     A gap in the 
sequence of known length. THe unkown bases are filled in with N's.
-+Fgap  gap     gap     SO:0000730      gap in the sequence     A gap in the 
sequence of known length. THe unknown bases are filled in with N's.
- Fgen  gene    gene    SO:0000704      region of biological interest 
identified as a gene  and for which a name has been assigned;     A locatable 
region of genomic sequence, corresponding to a unit of inheritance, which is 
associated with regulatory regions, transcribed regions and/or other functional 
sequence regions
- FiDN  iDNA    iDNA    SO:0000723      intervening DNA; DNA which is 
eliminated through any of several kinds of recombination; Genomic sequence 
removed from the genome, as a normal event, by a process of recombination. 
- Fint  intron  intron  SO:0000188      a segment of DNA that is transcribed, 
but removed from within the transcript by splicing together the sequences 
(exons) on either side of it;   A segment of DNA that is transcribed, but 
removed from within the transcript by splicing together the sequences (exons) 
on either side of it.
-Index: mira-4.0rc1/src/mira/adaptorsforclip.454.xxd
-===================================================================
---- mira-4.0rc1.orig/src/mira/adaptorsforclip.454.xxd  2013-08-17 
16:11:50.000000000 +0200
-+++ mira-4.0rc1/src/mira/adaptorsforclip.454.xxd       2013-09-17 
15:44:15.000000000 +0200
-@@ -9,7 +9,7 @@
- # sequences must be included extra in this file (see "rev_*"
- # down below
- #
-->unkown_lookslike_adaptorB
-+>unknown_lookslike_adaptorB
- ACTCGTATAGTGACACGCAACAGGGGATAGACAAGGCACACAGGGGATA
- >unknown_from_cDNA_project_titanium450bp
- TTCGCAGTGAGTGACAGGCCACTGAGACTGCCAAGGCACACGAGGGGATAGG


_______________________________________________
debian-med-commit mailing list
[email protected]
http://lists.alioth.debian.org/cgi-bin/mailman/listinfo/debian-med-commit

Reply via email to