Nilesh Patra pushed to branch master at Debian Med / mlv-smile
Commits: 63ce23f3 by Nilesh Patra at 2020-07-23T20:39:00+05:30 Fix gcc-10 FTBFS - - - - - 8d76235e by Nilesh Patra at 2020-07-23T15:13:32+00:00 Add autopkgtests - - - - - 4ce4a79f by Nilesh Patra at 2020-07-23T15:13:50+00:00 Install relevant examples - - - - - 10 changed files: - + debian/examples - + debian/patches/fix-gcc-10.patch - debian/patches/series - + debian/tests/README - + debian/tests/control - + debian/tests/data/alpha - + debian/tests/data/param1 - + debian/tests/data/param2 - + debian/tests/data/seq - + debian/tests/run-unit-test Changes: ===================================== debian/examples ===================================== @@ -0,0 +1 @@ +debian/tests/data/* ===================================== debian/patches/fix-gcc-10.patch ===================================== @@ -0,0 +1,15 @@ +Author: Nilesh Patra <[email protected]> +Description: Append relevant attribute flag to prevent gcc-10 FTBFS +Bug-Debian: https://bugs.debian.org/cgi-bin/bugreport.cgi?archive=no&bug=957551 +Last-Updated: July 23, 2020 +--- a/P_BLOCS/include/define.h ++++ b/P_BLOCS/include/define.h +@@ -20,7 +20,7 @@ + #ifndef _DEFINE_H + #define _DEFINE_H + +-int ALPHA_CARD; ++__attribute__((__common__)) int ALPHA_CARD; + + #define LEAF_BIT 0x80000000 + #define LEAF_BIT_INV 0x7FFFFFFF ===================================== debian/patches/series ===================================== @@ -2,3 +2,4 @@ Makefile.patch although.patch misc.patch mayhem.patch +fix-gcc-10.patch ===================================== debian/tests/README ===================================== @@ -0,0 +1,6 @@ +Tests for mlv-smile +=================== + +The data for tests has been referenced from the official manpage: + https://manpages.debian.org/unstable/mlv-smile/mlv-smile.1.en.html + ===================================== debian/tests/control ===================================== @@ -0,0 +1,4 @@ +Tests: run-unit-test +Depends: @ +Restrictions: allow-stderr + ===================================== debian/tests/data/alpha ===================================== @@ -0,0 +1,5 @@ +Type:Nucleotides +A +C +G +T ===================================== debian/tests/data/param1 ===================================== @@ -0,0 +1,17 @@ +EXTRACTION (Step 1) ======================================================= +FASTA file seq +Output file results1 + +GLOBAL PARAMETERS ============= +Alphabet file alpha //previously created +Quorum 100 +Total min length 13 +Total max length 13 +Total substitutions 1 +Boxes 1 +Composition in ? 0 + + +EVALUATION (Step 2) =================================================== +Shufflings 100 +Size k-mer 2 ===================================== debian/tests/data/param2 ===================================== @@ -0,0 +1,24 @@ +EXTRACTION (Step 1) ======================================================= +FASTA file seq +Output file results2 + +GLOBAL PARAMETERS ============= +Alphabet file alpha +Quorum 100 +Total min length 11 +Total max length 11 +Total substitutions 2 +Boxes 2 +Composition in ? 0 + +BOX 1 ================ +Min length 5 +Max length 6 +Substitutions 1 +Min spacer length 10 +Max spacer length 15 + +BOX 2 ================ +Min length 5 +Max length 6 +Substitutions 1 ===================================== debian/tests/data/seq ===================================== @@ -0,0 +1,4 @@ +> Seq A +AGGCTAGTCAGGGCATGCGATCAGCAGGCATCAGGCGAGCATCGACAGCA +> Seq B +GGAGAGCGCAGAGCGAGCATCATCATGCAGCATCAGAGATCTTTCT ===================================== debian/tests/run-unit-test ===================================== @@ -0,0 +1,23 @@ +#!/bin/bash +set -e + +pkg=mlv-smile + +if [ "${AUTOPKGTEST_TMP}" = "" ] ; then + AUTOPKGTEST_TMP=$(mktemp -d /tmp/${pkg}-test.XXXXXX) + trap "rm -rf ${AUTOPKGTEST_TMP}" 0 INT QUIT ABRT PIPE TERM +fi + +cp /usr/share/doc/${pkg}/examples/* -a "${AUTOPKGTEST_TMP}" + +cd "${AUTOPKGTEST_TMP}" +gunzip -r * + +echo 'Test 1' +mlv-smile param1 +cat results1 + +echo 'Test 2' +mlv-smile param2 +cat results2 + View it on GitLab: https://salsa.debian.org/med-team/mlv-smile/-/compare/a2b1ab97cde21166164b32886e0fe8a6c4a56ead...4ce4a79f5fdfcca95952125d792972e4738ab96e -- View it on GitLab: https://salsa.debian.org/med-team/mlv-smile/-/compare/a2b1ab97cde21166164b32886e0fe8a6c4a56ead...4ce4a79f5fdfcca95952125d792972e4738ab96e You're receiving this email because of your account on salsa.debian.org.
_______________________________________________ debian-med-commit mailing list [email protected] https://alioth-lists.debian.net/cgi-bin/mailman/listinfo/debian-med-commit
