Nilesh Patra <[email protected]> writes: > Since fetching it directly from a file location or a sort of API doesn't seem > the way out, writing a script directly looks not easy.
Programmatic retrieval is very much possible, via ncbi-entrez-direct: $ efetch -db nuccore -id CP014688.1 -format fasta | head -n175 >CP014688.1 Acetobacter persici strain TMW2.1084 plasmid pAC1084_1, complete sequence ACGAGGTCGTTTCTGTCGACCCGCTGGCTATATTCAGGCTGGTAGATGTCGGCGTGGTCTGATTATTACC [...] or, with a slightly different defline, ncbi-tools-bin: $ idfetch -t5 -s 'gb|CP014688.1' | head -n175 >gi|1149544201|gb|CP014688.1| Acetobacter persici strain TMW2.1084 ACGAGGTCGTTTCTGTCGACCCGCTGGCTATATTCAGGCTGGTAGATGTCGGCGTGGTCTGATTATTACC [...] That said, pre-retrieval does have the advantage of letting the tests work offline. -- Aaron M. Ucko, KB1CJC (amu at alum.mit.edu, ucko at debian.org) http://www.mit.edu/~amu/ | http://stuff.mit.edu/cgi/finger/[email protected]
