On Fri, Jun 18, 2021 at 01:45:13AM +0530, Nilesh Patra wrote:
> >
> > $ efetch -db nuccore -id CP014688.1 -format fasta | head -n175
> > >CP014688.1 Acetobacter persici strain TMW2.1084 plasmid pAC1084_1,
> > complete sequence
> > ACGAGGTCGTTTCTGTCGACCCGCTGGCTATATTCAGGCTGGTAGATGTCGGCGTGGTCTGATTATTACC
> > [...]
> >
> > or, with a slightly different defline, ncbi-tools-bin:
> >
> > $ idfetch -t5 -s 'gb|CP014688.1' | head -n175
> > >gi|1149544201|gb|CP014688.1| Acetobacter persici strain TMW2.1084
> > ACGAGGTCGTTTCTGTCGACCCGCTGGCTATATTCAGGCTGGTAGATGTCGGCGTGGTCTGATTATTACC
> > [...]
>
> I didn't know about this, thank you tons for the help! :-)
> Just added in a script for getting data
I wonder whether we should put that hint somewhere prominently since it
will be helpful also in other packages, thought. May be we should write
some kind of autopkgtest howto?
Thanks a lot
Andreas.
--
http://fam-tille.de